Description :
From Genome Similarity Track
Location :
Scaffold_129:63609- 65741
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_14416cyclin-like protein
Sappa_CBS223.65SPRG_14417PREDICTED: UBX domain-containing protein 6-like

Sequence
2132 bases(100 bases per row)
CGTCGGCTGGCGTTGTGGCAGGAAAACCGTTCGGTTTGAACCGTGAACCGCGCTGCACTCCTTTTTGTACCTCGCGTCCCTTTTGTCTCTCCACGTGTCG
AGCCTCTGTCTACATGGTGGACATGGCGCCATCACTTCGTTCGTCGCGCCAAAATTCAAATGTGCTGTTTTCAACTCCTTTAACTGTTTTATTCACTTTT
ACATACAAACGCACAGTGATGCAAAGCATCACGGTGTTTCGAACACATGCCGCGGGGGGCATCGCCGGATACTGTCCGGTTACGTATGGTTTGAACCGCG
ACATTATGTCCAATAAGACACCAAGTGGGTGCGTATGCGCTTCCTGATTGGCGGATTTGATGCGTCTTGTTTTTAATCGCTGCGATGAATTACGCGGGAT
AATGCAGCTTGGGATTTGTATGCAGCGGTGGAAAATCCAAAAATGAAAAATAAAAGTCAATGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NGACCCGTCATGCCATGAAGGCCGAGCCGCGGGACGTCATGCAGGTCGAGCCGCAGGATGCCATCAAGCATCCTCGGGCCGAGGACGAGATGGGCTTTCC
AGCGGTATGCGGCAAGAAGATGAAGCTCGATGGAACCAACCCGGTCAAGCTCCGACGATCCGCCCGCCTGCCACCTGCTGAGACCCCGCGGCTGTACCCG
CTGAGCTCTCGATCCAGGAACGACAGCGTCTCTTCGACATCAAGATGAACGCATCGAGTACGAGCTCCATGATGAAGATGATTCCTTGTATGGAGAATGC
TCATGCAGTGTATATAGACTCGGAGTTTGAGCTCAACGTCTATGTGGACGAGGTCGTCATGATCGACACGAAGGAGACCGACCTCCTCGCGCGCGAGATC
GACCAGTTCCACCGCAAGGACGAAGACGACAAACACCGCTTGCTGACCGACTTCATCAAGGAGGCCAAGACGGACCTGAGTGCTCGCATGCGAATGATTC
TCATCGACTGGCTCGTCGAGGTCGGCGAAGAGTACAAGGTCTCGTCCAAGGCGCTCCACCTCGCGATCTGCCTCGTCGACCGGTGCTTGGCGAGTATGAC
CCTCCATCGCAGCGAGCTCCAGCTTATGGGCTGCGCGTGCATGATCCTCGCGTCCAAGTACGAAGATGTCCACGCGCCGAGTGTCGAAGACCTCGTGTAC
ATCTCGGATCACACGTACACGGGCGACCGCATGCTCGAGATGGAAAGCATGGTCCTCGACGCGCTCGAGTTCCGCGTGAGCTCGACCCATCTCTACCACT
TTCTTGAGCGCTTCGTTCTCGCGGGCTGCTCCACGGACGTGCAGACGCACTTTGCCCATGTACGAGACCCATGCACTGGCAATGACCACATCTCACCACA
CGTGTAGTACGTGGCAGAGCTAGCGATGCTCGACTACCCTCTCGTCCAAAAGTTCAAGCCGTCAGTGATTGCGGCGGCCTCTGTCTACTTGAGCCGCGTC
GTGACGGGCGAAGCGACCTTTTGGGTACCTCGCACCGCGCGATGGATTGCACGGCTAACATCAGACACATCCCAATAGACGCCGACGCTGCACTACTATA
GCAAGTACAACGGCGTGCAGATCCTGGAGTGCGTGCATCATCTTCACAAGATCCACGAGAAGGAGTACACCGTCTTGCACACGGATACGAGTCAAACCAA
GGCCATCACCGACAAGTACATGTCACGAAAACACTTCCGCGTGTGCAAGATTGCTCCCGTTCCGCTTCCGGCGTAGCGTCCTCTTAATTTAATCAACGTA
CCCTACTTCATGCTGTATCATCACATCCCCCCATCCTCGACAAGATGCATCCCCATCGAGCGATCGTCACGTAGCTCAAGACCAACCTCGACACAGCGTA
GCAGGCGTGCTTCCGTTGTCTGGACGATGCGGTGCTAGTACATGGAGGATGCGAATTGATTTCAAGATTTGATCTGTCTAGCTCGTATGCCCCAGCGTCT
CGAGGGTCCGTTGCAGGAGCTCCGTGGACGTC