Description :
From Genome Similarity Track
Location :
Scaffold_1482:636- 3319
Sequence
2683 bases(100 bases per row)
TATTTCAAGATCGCGAAGGTTCATGATGCTCCTGAGGTCATGAGAGTCACGGATGGTAGACCTACGGTTTTTGACTTGGGGATTCCTACACCCACGAACA
TGGGTCCGGTCCTTGGCCGAAGCTCTTACATCGATGACATCGGGTTTTGTTCCAAGGATCTCGGAGAAATGGCCAATATGTTGGATGCTCTCCTCTATCG
GTTGAGGTATTGGGGTGTTTCGGTTAGTTTGCCTAAGAGTACCTTCGGAATGCACTCAATTCCGTACTTGTCGCATGACATTTCGCCGGAAGGAGTCAAG
CCGATCTCCAAACTCGCCAAAGGCCTTAAAGAACTTCCGTTCCCcAAAACTCTGAAGGGAGTTCAGTCATTTCTCGGATCCTTGAACTACTATCATAAGT
TCATTGAGGCTACTCGGTGGTGGCAGCTCCTCTTTACGAGTTATCGGACGACCAGGTGCGAGCTGGGACAGATCTCGAGTCTGCACATGCAGCGTTCGAG
GTTCTGAAAGCCAAGATGTTGAAAGCTCCAGTTCTCcGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNGCTCCAGTTTCCCCAAACACTCCCACGGTATACATGGTTCAGACTCGAAGTTCCAGGAaCCGACCCCCcGTTTCcTCACCG
GACCTCGAACCACCTCCTAGCTCTGTCGGGGGgCGTACCGGCGCGTCAGAATCCCAAGGTTCTTCATCGGAGAATCCTGGAGACGAGAATTTtCGCGCAA
ATATCTCTGCAACAGACCTGGAGATGGCTCGAGCTGAGAGGTGGAGGCGTATTAATCGGAACCAAGATGCAGACCCCTGGATGAAGTCGCTCATAAACTA
CCTCCGAGGCGATCTCTCCGAGATCTCGCAGGCGAAGCCAGCAACTTTGCCAAAATCGCCGAACGATATGTTCTAGATGAAGAAGAAACGCTACTCTACG
TACCTCCAGTCTCCAAGAGACGACCCACTGGTAGGACTCCAGTAACCCGAGTTGTGGTTCCACACTCGATgCGGGATGACGTTCTACACGAGAGTCACTT
GGATTTTCAAGGTGGACATCAAGGAGTCGGGAGGACATATGAGAAAGTTTCAAGGAAGTTCCACTGGGTCGGTATGTTCAAAGATGTTGAAGGTTTTGTC
CGAAGATGTGTCGACTTTTAGAGGGGCAAAGGAATCCCCAGGCAACATCATGCCGGAGTATCCATTTCACGTAGTATCCATGGACTTTATCAAACCTTTA
CCAAATACCGATCGTGGGAATACGGCTCTGTGAAAGaCTCATGTTTGCACTCAACACCTCCTACGACTACACTCGTCAGGAAACTCTGTTCTTTCTGGTC
CACGGATGGGATGCTAAGTCGACTATGGCCGCCATGCTAGGTCCGCCACCTACCCGTCGAGATCTTGTCGACCCTTACCGTTGGAGAATCCGGGTTCAAC
GCCAAGTCGAGTATGCTCAAGCTTGGGCCCgAGATCTACAGGCCAAAACCAAaGAAACGCGAGCAGAAGCCcGAAATCTCCAAGTTCAGAACATGCCAGA
TACCGTTCCGATCCCTCGGGTCCGTCCGGGTCTCACCAAGAAaCTTGCACACTTGTGGCATGGCCcTTTTcGGATTGTGGAAAAGGaTCCAGATAACGAC
TTCCGATACAAACTCAAGGTCGATGGCGTCGAGTATCGTTTTTTtCCTtGGGTCCATGTTAGTCGCTTGAAGCCACGCATCCAAGTTCCTGAACGTCCTA
CGGTCCAGTTGCTCGAGCTCGAAGAGGATGACGAGTTCGATTCGGCACTTCTGCCCGAAGATAGTTGgCAaCCTGAAGAATTG