Description :
From Genome Similarity Track
Location :
Scaffold_209:63596- 69775
Transcript NameFunction/comments
g14624.t1RAW30699.1 hypothetical protein PC110_g12940 [Phytophthora cactorum
g14625.t1XP_009518137.1 hypothetical protein PHYSODRAFT_487796 [Phytophthora sojae
g14626.t1ETI34902.1 hypothetical protein F443_18676 [Phytophthora parasitica P1569

Sequence
6179 bases(100 bases per row)
TCCCGCTGTTCTCCGTGTGCGTATATGGTGATGTTGTAGCGACGCTGTACATCGTTATCTACGCCAAGTGGTGCTCGGACCGTGTATACGTGGCCAAATC
CATTGTGGTGGCAGGAATACTGTTGGCGTTGGTTACCACGTACGCCGTTTTGGTCGCGAGTGGGGCTATCAGCCAGTCAAGACACCAGCTCGGCCTCGTG
CTTGGCTATTTGGCTAATGTCGCAACGTTCGCCATGTATATCTCTCCACTCGAGAAGCTCAAGCTCGTGATCCAGACCAAGTCGTCAGCAGCAATCCCCG
CACTTCTGTGCGGCATCATCTTCGTCAACAGCACCCTGTGGCTCATCAACGGTATTGTCGACGACGACCTCTTCATCGTGGTGCCGAACGTGGTGGGGCT
TTTACTAAGCGCAACACAACTTACGTTGTATGTCATCTACCGTCCCAAGAAAGAGGTGTCGGCAGCAGACACGAGTGGAAGCGAAATCAACGCTGTGCTG
GGTCTGGAAACGGGTATTTCTGAGCAAGTTGCCTTACCAAAGAGTCCAGCATTTCTCTACTAGTGTCACCCAAGCATTTTCTGAAGTAGAAGTCCAACAT
TATTCCCCCGAAGGGCGTCCTATAGGTACTACGACGAGGTGTTTCTGGACGAATGGGGCTGGAAGCTGAAGCACGTAGCCACCTGAAATTACCCCCCCCC
CCCCCCCCCCCCCCAATCCACGAAAAGATCCTTTGGTACACTTATTTGTTGAAGTTTAACCATAACAGCCGCAACAAGAGCGGGAAAGCTGCTGCGTCAT
AACTTCCATCAACTCACCACGTCCGGAACATCCTACACAGCCACACTGCTTTTTCATTACTCGTCGCAGTACCTCGTGACGCTTTAATGCGTTCCAAAAT
TTTGCTCTGCGTCGTGAAGTGCCCCCACTTCTCCTCCATGAGTCTTCTTTTTATCGTATCACAAAGAACCTTTGCAATCTTGACGTTGTTTTTCGTAGTG
GTTGCGGGATATGCGGCCCTGATTTCCATTGAGGAGCATCGAGCGACAAGGAGTTTCACAGCGTCGATGTGATTTCTGGAGACAGCACTCCTCAACGCCT
TGCTGACGCTGGATTGCTGTAACTCCACGCCTAGCAGCACCTTCACTGCATCACGTTGGCCTTCTGCTGCAGCTTCTTCGAGCGCACGACCAAGGTAACA
CCAGCCGCAGTTCTCATGCACGAGGACACTTAAAGTCCCAATGTCTCCTCTCACTGCGACCACTTGAATCCCGTCAGTGATCACATACGGCTCTTGGTTA
TTTCCCATTCGGTTGCTGCGACACAGCCACTTCACGACATCGCTATGCCCATTCTTCGCTGCAGCGTTCAACGCAGCACTCGAGCACCTTGTGAAGTAGT
GAGCACGGAGCCACTTCACGACGTTCACATGTCCGTTCACCGCAGCCTCATCCAAGGCGGCGATAGAGCATCCTTCGTTGCGAACGACGTACAGCCACTT
CGCAATATCGAGTCGTCCTCGAGCCGCTGCTCCATCCATCGCATTCTTCGTCCACTTCCTAGTGGTTCCATGCACACGAACGACGTACTGGCAATCGTTG
TAGACGGCGGCGTCGATCGTCTCGGGCTTAAGGAAGTCATTGATTTGGTCAACCACGTGCGAAAGCGCTTGAACTCGCCCCGGTAGCGTAAGGAAGACAG
ATGTGAGTTGCGGTTCTCTCATAGTTGGCATTTTGCACAGTGACCGTCGTCTTGGTGCCTTTGCTGGGACGTGGCGTCTTGGCACCCACGTTTTCTCTTT
TTCGCATGTGAGAAACGCAGTGATGGAGTCCACCGCGCGTGTATTAAGAGGTCGTCGCCTAGAATGAACAATGAAGTGAACGCACACTTTACCGATACGT
TTTTTTTTTCATTTGAGTCCAGCTTCGGGTACGTCAGCTCACTACATGCCGGTTTGTCAGTTTTTTTATTGGGCCAGCTCAATTTCCTCTACGTTCGCCT
TTCCTTCGTTTTCACCCTCGTCTTTCGCGTCCTCCACGACCTCCTTGGCCACCTTCTCGACCTCCTCGGTAGAATCTTCTTCGACTTGGTCAGTCACGAT
TTCCTCGTCCTTTTCCTGCTCTTGCTCTTCCTTCTGTTCTTGTTCATCGACTTGCTCGCTTTCCTCAGACGCTACCTCCTGAGAGGTTTCTTGGGGTTCA
GCTACAGGAGATGCGTCTTCGCCACTCTTTTCCGGGAACTGAGAGTCCGCTTCCACACCCTTAGCGGCTTCATCTTCACCCCCCGTAGCCATCGCAGTAC
TGGGTGCAGCTTCTGTAGATACCTCAGCTTCGACACTCTCACCAGCAATTTCCTTTTGCTTTAGCTTGGCCAAGATGCGGCGTGCGGTGTCGGCAAAGTC
TTCGGCATCATGCGTGGCTGCTAGCACGTCCATTGCCGCCAGCATTCGGGCATCCCCGCTGCATACCAGCTCTTCCACGTGCTCACGTTCGTCAGCTGTC
ATGACACCTTTATCCTCCAGCTCCTCCAGCAGAGCCAAGACCAAATGCCCCTCCTCCGATTCATTCCGTTTGGCGTCTGCCATCACGTTCTTCAGCTTCA
TCGCTTCGAGGCATGCGATTCGCGTCAATGTATCGACGAACTCTTCCTTGTTGCCGTCACTCAAGTAGACCACCAGTGCTGCTACAACGCGGTCATCACG
AACCTTCACGAGCTGCAGAAGCCGTTCAGCTCCACCGCGAGGTAGATTTCCCCCTCGTGCCAGCGGGGCGATCCAATCGTGCACGATTGCATGGCGATGG
CGCTCCCAGGCCGCCAGCTCGACCAAAATCTCGAGCGTTTCAATGAGTTCTTCAGCATTCTTGTCCTCGTTGTACACATCCACTGCAGCTAATAGTCGCG
GGTCGTGAGCTTTTAACAGGCACATCAGTAGCTGGATTTGCCACAATTCAAGACGGCCGGACCTTCCGTACTCCGCTAGAAGTCGGGATACAGCCTGGCC
CTCGTCAATAGGTTCGTCATCTGTTCCAAACCGCGCGTGTTTGACCACGAGAAGCAGCGTTTCTTCGAGTTCGTGTACGTCTCCGTCTGCCTGGAACGCC
TCGTTGGCAGCTTGCAGGGCCTCGTTGCCACCGTGGAACAGCACCAATAGACCTGCCGCATTTCCGGCTTGCACCACTCCGCGCCTCTGCATCTGACGCA
CGACGTCCTCAAGGCTAAGACCGCTAGCCGGCGCACCATTCAGGACGTTCTGGCCTGCTTGGCTCTGCTCAATCTGTCGCTGCAGTTTGGCCACACGCTG
GAGCGTGTCCAAGAGTTCGGTGCCATCACCGTCACCTGCAAACACTTCATAGGCACTCTCCAACAAGTTGTGCTGCTGCGCCACCATTCTGCGCAACGTG
TTGGCATCGGTCGGGGTCAGATGATGCTGAGCTTGCCACTGTCCGAGCAAGAAGCTCAGGTGTCGCTGCCATCCGAACGGGTTTCCGTCCTCCTCGTCGC
TGTCTTCCCACTGGTTTTCTTCTCGAACCGCGTCATCCAGTCCACGTGCAAAGGCAGCAGCAGCCTTCTCCTCGTCGCCAAGCTCCATCGTAATCTCCTC
CACAATGCTCACGAGCGCATCTCTCAGTGCACTGACATCGCGGTGATCACTCTGCTCAAAGTCCCGCAGAAGCTGGAGCACCTGCGAGTCGTCCTGAGCC
ACGAGTGCCTGTATGATGTCCAGCTCCAGACTCGTCAGCATGTGCTGCGCGTGCAGGGACCGCACCACCGACACTGCAGAGGGAACAGCCGCCGCAGCAT
TGCGCATCCTCTTCTTGGCCGGCGAGCCGTTCGTCTTGGTGAGCCTCCCTTTGCTCTTCTTGCTAGCAATAGGCTTGGGCGGGTTGCATCCGAGCGCTGC
GAGTCTCTTGGCTGTAGTCTCCAAGTCCGTCAAACTGCCTCCGTCGTTCTTGTAGCTCTGCAGGGCACTGAGCAGCACCCTGTTGCCCCCCAGCACGAGC
TCCAGCAAGTGAGCTCCATGGTCCTCCGGCAGCACGTGTCTGTCCAGCAGCTTCTCCAGCATGTTCAGCAGCTGCATCGTGTCTGCAAACCTGCCCTCGT
CTGCATTGCTGCCCTCTTCTCCAAGGCTCCACTTGTGTCTCGTGGTGTCCGCCAGCGCCAAGACCTGCGTCTGAACCTGTGGACTGAAGACTCGGCGGCC
AATCGCCACCACTTTCTTGGCCACGAGCTCAGCTTGCAGAGTGTCCTCCTGTCTGTCCTTCTTCGTTGTACGAGTGTCCTCCTTTCTGTCCTTCTTCTCT
GGGCGAGTATTCGCTGTAGCGTCCTCCGGTCGTAACAGCTGCAGCAGAAAATCCTTCTTCTGGTCCACCGACGTCCTCCCGCCCATCACAGCCAGCACCT
GGTCCCTCTGCTGATCACAAACGTCCCTCAGCACGGCCGCTTCAAACGCGGACAGCTGCAGCTCCGTCTCCAGCGCCTGTAGCAGCCTCTGCAATCTCTT
GTCGGTGTCCTCAGGTCCTAGAGCGCGCCCAGAGTCGTTTGACGGCGCCATTAACGCGGACACGCGCCCTGTCAGCAGCTCAGGCGCTTTGCAGGCCACA
GACAGTGGCACGAGGCGCGGAATCCGCTTCTTGCGGCTTTTTGACGCTTCTGGGGCCACTTGGAAGCCGCAGCACGCGGCCCCACCCGTCTGTAGCGCCG
CACGCACCAGCATCTGCAGCTCCTGCGCCTCCATACCCGCGTACAGCGCCAGCGTCGCCCCCGAGAGCTGCACGTACGCTACGTCCCCTGCCATGCCGAT
TCACTTGCTTTCACTATGTTATCAGGCGCAGAAAAGATCGTGGTGTGGTGCGGTGTGGTACACGTAGTCGTACCCGTAAAATGGTACGTCGGCTCACGAG
AAGTGCTTCTGTGTCCATTGGTGAGAGCGTCACTGTCGATTTGCTGAGTTTGACGACGTTTTGGCAAGGAAGATGAGCAGTGTGTGGCCTGCAGCGGATG
ACCCGCGCGCCAAGCTCTTCAACGGTGGGTTATTGTCTGCGTAACCATGCGTGGAAGGCGAGATATCGCTCACGCAAGAGTTGTGGCACTTTCAGACCAG
GTGCATGGCTACATCAAAGTGAACGGCCTGTGCGTGTCGCTCATGGACACGCCGCAGTTCCAGCGGCTGCGGGACTTGAAGCAGCTAGGCACGCTCTACT
ACGTCTTCCCGGGGGCCTCGCACAACCGCTTCGAGCATTCGCTGGGCGTGAGTTTCCTGTCTGGGCAGACTGTCGACCGGTTCCGACAGCAGCAACCGGA
GCTCGAACTTACAGAAAGAGACTCGCGGCTTTTGGTACGTTCGTGTAGCTGCAATTGGAGAATATTCAAGGAGGAGACTGATGAGTTTTGGCTGCAGAGT
GCTGCAGGACTGCTGCACGATTTGGGTCACGGCCCGTTCTCCCACGTGTTCGAGCACGAGTTCATGCCCAGAGTGGCGGCTGCGCGAGGATACGGTGGTC
CTGACGCGCCGGCGTATCACCATGAAGATATGTCGCTGCGGATGATTGAGTACATGGTGGACGACAACAATATTGACTTGGAGAGGGACGATGTGCGGTT
CATCCAGCAGCTCATTGTCGGAGCGAAAGAGTGAGTCGGCGAGTTGGGGTGTTGCGGTTAATGCAGTGAAGACTGACGGAATGTTGGGGATTGGTGGCTG
GCAGGACGCACATGGGCTCGCGCTTGGACTCGCGGGGATACCTGTACGAAATCGTGGCGAATGGACGCAACTGCATCGACGTGGACAAGTTCGACTACTT
GGCGCGTGATATGCTCAACCTCTTCGGGCTGCGCAAGGTGTTTGACTTCTCTCGACTCACGATGTTCAACCGCGTGATCGACAACGAGATTTGCTACCAC
ACGAGCGTGAACCTGGACATCTACGACATGTTCCAGCAGCGCTACCAGATGCACAAACAGATTTACAACCACCGCAAAGGCAAAGCCGTCGAGTTCATGA
TTTGCGACGCGATGCTTCTAGCTGACAAAGAACTAGGCATTTGTGCCGCCACGCAAACTCCAGAGGAGTTCCAGTTCCTCACGGACCACGTCGTTCACGT
ACGTATTGAAGCTGTACATGCGCCGATACTGTTGAAAGAACTAGCTCTTACCTGCGTTGTTTCGTGCTCTGCAGTCAAT