Description :
From Genome Similarity Track
Location :
Scaffold_7:63588- 65342
Transcript NameFunction/comments
Physo_519361myosin-like protein

Sequence
1754 bases(100 bases per row)
ACATGCACGAGGCGCCGCTGCTCAACGTGCTGCGCCAGCGCTTCGAGCGCGACGAGATTTATACCTTCACGGCGGATATCCTGCTGTCCATCAACCCGTA
CAAGTCCATCCCGCTGCTCTACGACGTCGTGGGCTTTATGAAGAGCCGCGAAGAAGCTGCCACCGCCACGGGGGACGGTTCTACCAGCGACAGCAGCGCA
CCACCTCACTTGTTCTCCATCGCTGAGAAGGCCTACACAGGCATGAAGGGCGTCGTTCCTGGGTCTGGAACCCCGCAGTCGATTGTCATCAGTGGAGAGA
GCGGCGCCGGTAAGACCGAAGCCTCCAAGTACATCATGAAGTACCTCGCCACTGCGAGCAAACACGCCGCCAGCTCTAGTACAGTCGCTGCAGGCGTCCA
CGAACAGATCGAGGAGTGCGTGGTGCTCTCCAACTTGATCCTCGAGTCGTTCGGCAACGCCAAGACGTCGCGCAACGACAACTCGAGCCGCTTCGGCAAG
TACATCCAGATCCACTACAGCAGCGAAGGGCGCATGGCGGGCGTGTCCATCCGCCACTTTTTGCTGGAGAAGACGCGGCTCGTGCGACCGGAAGTGAACG
AGCGCAACTACCACATCTTCTACCAGTTGCTGGCGGGTCTCGACACTCTGACAACCTCGTCGTCGGACCCTTCGGACTCGGATCGACCCTTGTTGCTGCA
GAATGACGTGTGGAACTACACGTATCTGACGCGTGGAGACTGCGTCGAGGTGGACGGAGTGGACGATGCCACCGAGTTCGAGCAGCTTCGTCGGTGTCTC
GAGCAGCTCGGAATGGACAACGCCAGCTTCCAACGCCCTATGTTTGAAGTGCTTGCAGCCATCTTGCACCTCGGTAACGTGCAGTTTGAGAGCCCCACAA
CGCAGGACGACACAAATGGAGACGATAGTCGCGAGAACGACCCAACACATGTCGTGTTCCCAGAGAGCGACGCTGGAGTGAACTTGGAGCACGTTGCGAT
GCTGTTGGGTGTCGATGCCGCCGAGTTCGCGAACAAAATGGTGACGCAGACCACCGTAACTGGTCGTGGCAGTATCCTCGAGATCAAGCTCACACCGGAA
CAGGCCAAGAATGCCATGGACGCCTTCTGCAAGTACCTGTACGGCGAGCTCTTCCACCACGTGATCACACGCATCAACGCCTGCGCCAAGCAGCAGACGT
CTCTGATCCCCACAACGGACAAAAAGACGCCAAAGTCTCGTGTCCAAGGCGGTGCAACAGCGCCCACGGTAGCTCCATTCATCGGCATCCTGGACATTTT
TGGCTTCGAGGTGATGAAGCGAAACAGCTTGGAGCAGTTGTGCATCAACTTCACGAACGAGACTCTGCAGCAGCAGTTCAACAAGCACGTATTCGTGCTG
GAGCAGGAGCGATACGCCCGAGAAGGCATCGCGGTGTCCCCCGTGGAATTCCAGGACAATCAGCGCTGCCTGGACCTCATTCAGAAGCCTCCTCTCGGAC
TTCTGCCTCTGCTCGAGGAGCAAATGCTGCTCAAGCGCAAGACCACGGACAAGCAGCTCCTCACGATCTACCACGGGAACCACCTCGAAAAGCACCCGAG
CTACGCGAAGCCACGCTTCGAGTGTGACGAGTTCATCATCCGCCACTACGCGGGCGATGTCGTCTACGATATCCACGACTTCATCGCTAAGAACACCGAC
AACCTGCACGACGACCTGCTCGACTTACTGCGTCGCAGTTCCCAGCCGCTACTG