Description :
From Genome Similarity Track
Location :
contig_25:63579- 65130
Transcript NameFunction/comments
g4891.t1hypothetical protein

Sequence
1551 bases(100 bases per row)
GTGTGTCCAAGACTCCACCTCACATCGATCAGCTAGCTTCATGGTTATCTTGTACCAGTACTGCATCTTCCTCGTTTCGGCTTCGTCCGCTCCTTCATCA
TTTTCAGCTATCTCCGACCACGTGTATTCCATTCCACTCCATTTTGACTGCCCTTGCCAAAAGTCTATGCAGCCCCGTAAATTCAGCTACGTTGTTGGTG
GTAGCTCGACTACCAAGCGCTGTCGCCGCCGCCCACAACACTACAGGTAATACCTCGGCGCCCTTGTCCTCGACGATGATACTCCCACTGCCTCCCGCAC
CTGGGTTACCACGGGAGCCGCCGTCAAAGAACCCAACCCAAAGCACATCGTTCCTCTTCTCCGGCACTGCGACGAAATCCTTTCTCCTCCAGTGCCGAAG
GATTTCTCCTGCAGCCTGTATCTTGGTATATGAAGCGGTAGTCATTGGGTACAGTCCCAAACGAAAACGCTCAAAGGCTTCCACTACACTTGTCTGGTAT
CGTCTGAGTTGGTCCGCAATCGCTGCAGCTTTTTTCCTTCTGGGTGAAGTCGATCCACATTCCATCGCCACAAAGCGGTCAACGTAACCGCGCAACCGAA
AGCCCACATGGAGCAAGCACTTCGGTGACTTGATCCCATGGCTCCACCTCCTGCTCGACACCCCATGTAGTTAACCACCCCGGCATCTTCTGCAACTTGA
ACCCGAACATTTTCATGATCGCCTCCTCTTGTGTGTCTTTGATTTCCCATCTCATGCACTTTGCACCCTCCCATTTTGCACAGTAGAACCTCAGTGATCT
TGCGCCTCCTCGCAGTCCCATGCCAAATGTGCCGATCCCAATGTCTTGCTGTTGGTGCATCCAGCAGCAAGGCACTTGAAATTATTTTCTTTGCCGGCCC
ACAGACGAAGCCTGTTGTTCTTTAACCGTACCACCGTATGAGCTTGATAGGCGGTGACGCCTTCCATCCTGTGAATCCTCTTCCATTTCAACTACTCTAG
GGCCCGGCCATGCTAGCGTGATTCGCCTTCCACGCCTCCCCAATCTGAGCTTCGGCCTTGATCGCTGCTGCCTCTCTCCGTTTACCAATGAACTTCTTGT
AGGACTACCTACTCTGCTTCCATCTCCGCTTTCCAGCCCAAAGCGGCCTCATCCGAGTCAGCCATGGGTGGGGCAGCACCCAGACGGACGATGTCTCCGC
CTCCAAATAGTTGGGACTCACCCTTTGTATCTATGGTAAGGCCACTTAAGCTTGAGAAAGTGAATTGCATTCTGGTCGGCTATGGGGACCTACCAGCTCG
CTGCCTGCTTCCGTGCTGCTCCTTGTCCTCGTGGCGCTGTCGCCCAGTCACATGAGCAAGAAGCGCCTTCGCATTCACCACACGTCCTTGCTTCAGTATC
ACCTTGTCCTTGTAGCGCCTCCCATCGTTTCTTCGCAGCACTGCATCTCCTACAGCGTCCTTCATCACTTCTTGGCGCACCGCATCTCCTGGGACATCAG
CGTCTCGTTGTTGTTGTTGCTGCTTTCTGCTATCAGCTTTGAGAGGTATGC