Description :
From Genome Similarity Track
Location :
Scaffold_32:63576- 65938
Transcript NameFunction/comments
Phyta_totarag1644hypothetical protein PHYSODRAFT_295280
Phyta_totarag1645hypothetical protein

Sequence
2362 bases(100 bases per row)
CGACGGCATACTTGGCTGGAGTGCTGATCCCGACTATGAACAACTTCGTGTTTTTTGTCGTGTCGCTGTGGCTCGGTTTGCTCTGCAGTCGTAGTCGCAA
GCGtgtgctgcgcagcgccCCCTGCAGCATTAGCTCCAACCTGAGTAAGTCTCGTTTGATGTCTTTGTGTACTATTCGAGTGTTATCTAACCTTTTTTTA
ATGTCGTTGCGGCCATCCTTTTGAACAGAGTCGGCGTTCATGCTTCCATGTTACGAAGCGATCTGGTACACTATTGCTGCGTTGTCAGCAATTGGTTTGG
TACTGTACTTCGTCAGCTTTCAGGTTTACAAAAACGACAGTGGCAAGACATACAGTGCACTGACGCTGAAGGACGATCCCAACTACCCGTGTAGTGTGGT
TACCATGCCGTCCGTGTGggtgttgcagttgctgccaATGCTCATGATCCAGCGCAGTGTCTCTCAAGAAGCAGTGCTACGCGCCATATTGTACTCTGGA
ACAGtgtgcgtcgtcctcgtgATATGCAATATGACGCTGTTCAAGGTTGGTCATGATATTGCGGACGCGATCGCGATGACCATCCACGTCCTGTTGCTCT
TGTTTTACTTCTGGGCCAAGTTTATCTTTCACGCTCGTGCCAGTTTTGATTTTTTCTTCGCCGCTGCCGTGGTTACGTCGCTAGCAAACATCACGAGTTC
CATCATGGGGCTCGCTCACGTGGATGCAACTTCCACATTGCCGATTATTCACTGCATTGTCACCGGACTGGATTCACTCATCGTCGTAGCTGTCCTGTTA
TCTCTGCGTGCCGATACCCGATACTGGCTggccatcgacgacaacggATCAGGcacgacagcgtcgtcaagCGCAATGCGCCGATACGTGAATTTGCTCT
CGGAACGCGGCATGATCACCAACTTTTCCACACGAACGTCGGTGTACGATGTACACCACATGATCGAGGAACACCGGCACAACGTTGTGGACTTCTCGGC
TCTGGCACTGGACTGCATTATTGCACAGGGTGCCACATCCGTTGTGATGCGCGGAACACTGCGTGGGAGCACTCCTGTGCCTATCGCGCTCAAGATTTAC
ACCGACGTACAGGTGACGAACGAGGAAGTGGAGCGGTTTTCGCGGGAGACAGCATTGAATGTGCAGTTGTCGCACCCGAACGTCGTTCGCTTCTACGGCC
TGTGTGTGGTGCCACCGTCTATCTCGCTCATATTTGCGTTTTGCGAGTATGGTGCGTTGGACGTGACATTGCGTGAAAACCCCGAGATTTGGACACTCGC
AGCTAAGCTCAAGGCGTGGTTGGATGCGTGTCGCGCGGTTGCCTATTTGCACAGTTTCTCGCCTCCACTACTGCACCGTGATATCAAGACGGACAACTTC
TTGGTGGGCCAGGATTTCCTCATCAAGCTCGCAGATTTTGGTGAAGCCAATTTGCTGCGACCACGGACAGACGGTACCATGACGATTGCTGGCACGGTCG
ACTACATGGCCCCGGAGATGATcaagggcggcaagacgGCGCGTTACGGCACGGCTGTAGACGTTTACAGTCTGATGATCACGCTTTGGCAGATCATGGT
GCCTACACGCAGTCCTTGGGAAGCCAAGTCTCACCTTGAAGTGTATCGGTGTGTGGCACACGGTGACAGACCTCCACTCTTTCCGACCATCCCGAAAGCC
TGCGCTGAAATCCTCGAGGCTGGATGGGCTGCTAATCCTAGTgatcgtgttgctgtcgaggATATTATACCCTCGGTCCACCGCCTTTGGTTGCTTGCGC
TGCACCAAAAGCCTCTGAAGCGGACGAAGCCTTGAGGCTTTGACCAAAACCACTACCGCCCGGACGATGTAGACTGGGTTGAGGGCGTACGCCTGTATAT
ATATTGTAAATTTGCTGTTGAGTACCTTGGTTTATCGGTCGAATTCGTTGACTGCATGCGGTCATCCGCAATGCCTACAAACAATAAAATCAGAGTTCTG
TTAATGATCGAGGAGGCTCCGATGGTGTCACAGCCGCACTATCAGTTGCATCTCGGCTCTCGCGTTGGCGGTGCTTTCGTGACGAGCCACTCTTCTTGTG
ATgcgaagaggatgaagccGTGTCGTCCTTGTCTTTgtcttttttcttcttcttgccgctcttcgacttgcttTTGTTTGAGCCATGCGTagacgcgctg
ctggagaccGATTTCGTGGACACGCCTTGCTTTCGTAGTACCTTGTCTCGCTGAgcttggcgctgcttgacTTGCAGCCTTTTCTTGCGCTCCTTTTCCT
TCGCCTGCATTTGCTGCCAGTCCGTGTCGAATACTTGCGATTCCACTTTTCCTAGCACTGGT