Description :
From Genome Similarity Track
Location :
Scaffold_320:6357- 8295
Transcript NameFunction/comments
Physo_144909reverse transcriptase

Sequence
1938 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAACACATC
GTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGAAGGTCGCAGGACCGTTCTTCAGACCCTGCGGCATCACT
AGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCACAGCCGTGAGAGGGATATCGCTCTCACGCATGAGGATTTGATAGAACCCATCGCGCAGATCAAGAG
CACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATGACATCTTTTCGCGGTATCGGTGTCTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTGTACGC
ATGAACGATGCGCCAACCGCCCTGTGGCTTCTTGACACAGAACGTCGGAGCACTGTGCGGGGATTCCGATTCCCGCACTTGTCCAGCTTTGCGACGACTC
TCAAAGAAGTCGTCGATCGCCTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAGTACTTCGTGCCCGGCACGAGATCAATCTCGTGCTGGA
TGCCCTTGTCCTGCGGAAGCTCCGTAGGGATCTCTTCCGGAAGTACGTCCGCGTACTCCCATAGAATCTCGTAGAAGGGACTCGTCTTCAGCGAGTCCCA
GCTCTGCTCCTCAAAGCGCTCCTTCTTAGTCTTCGCACTGAGAGTGTCCTCGCTCTCAGTGGTGGTCTCCATGAAGAACTACCTCAGTTCTTCATTCTCG
CTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGTTTCCAGCTTATGACTGGAAGCGAAG
TCAACTCCGACGATTGCGTCGAAGGATTAGCGATAGTCATCTCCCTGTACCGGAACCCGGGACAGGTACGCGTCAAGACGTTCAACGTCTCGACGTCCGG
CTTCTCAGCCTCTGTCTGCCCGGCAGACATTTCTTGTAGCGCCTCGTCCCCAGGACGAGACTTGCGTAGCGGCCTTCGCATGCGCCGTCTTCTTGTTTTG
CGGAGTCCGGCTCCGATTGGTTCTTGACCTCGTCCAGGCCCAGCCGTGGACGAGTGTTCTTCTTGTATACCGCCGGCCGGTATATCCCGCGGGCGGGCGA
CTTCAAACCCGGCTTGGTCGCCTGGCGCTTCGTCGTGCAGCCCGGCTGCACGACAGCATGCAAGTTTTTCCGGTGCGGGACATTTGCAACCGTCCACACC
GCTTGCAGCGTCGGCTCCCGGAACCGACACGCCATCTTTACCTCGACGCCTGTTATTGGCGGAGCTCTTCGTTACAAAGGGCGCGTCGACTCCCGGAGTC
GACGCGAAATTCCTTTTGGCAGCGCCAGTTCCCGGAACCGTCGCGACTTTAATACCTCGACGCCAACCATTGCCGGAGTCCCCTATTACGTAGGGTGCGT
CGGCTCCCCGAGCCGACGAATCAAATTCACCCAATCCATCGACTCCCGGAGTCGACGGCGTTTCGTCACCTTGACTCTTATTATTGACCAAAACTGATTC
AATCAGATTCGCGTCAGCCTCCACGGCTGAGGCGTGCGGCTCGCCTGCGTCATCCATGCCCGTTGAGGTCGGAGACTCTTCTTGATTCGCTGAAAAGCGG
GTGTCGATCTCCGAGATCAACACATTTCCTTGATTAGCTGTCGGTGGCGACGCCGACGCTAGCTGCTCTTGCGCGCGTGCTCGCGCGCGCCCAGGGCGCT
CCGGAACAGCAGCATCAGGCGCTGTCTCGAGTGGGGAG