Description :
From Genome Similarity Track
Location :
Scaffold_9:63546- 64836
Transcript NameFunction/comments
Phypa_INRA-310PPTG_06125hypothetical protein

Sequence
1290 bases(100 bases per row)
GCCTTCTGCCGATTCTTGCTCGATCCGAAGTGTGCGCGTCCCTGACGGTTCTTCGCACGTTGCCTCGCCTGCAGTACCTCTTCTAGCTCATCGGCATCCG
AAATACGCAGCAACGCAAGCTGATCAGCTAGATCGCGGTCGTCCTGAGTCTCGATGAAATGTTCTACGTGCTCGCGTCAAACGTCGGATGGGCCGCTCTT
CACGCGCAGCTTTGCCCTCAGTCCTGCGACGCTCAGGCGGTGCAGGTATTCCAGCGGCGTCTCGTCAGCGCGCTTCTTTGCGTGGTAGTATTGTCTTGCG
ACAGATACTCCGAGTCCGCAGAACTGTACTTGGAATTCGCGTAGAAGCTCTTTCCAGTCGCCCCTCGTGGTTCGACTAAGTTGCCGGTACCAGTTACGCG
CTGATCCAGTGAACAGGCCACCAAGCACCAGGCATTTCTCGTCGTCCGGGGCCTGATCGCGGACGAAGACTGACTTTACCTTGCCGATCCAAGCCCCCGC
GCAATCCTCGTCGTCGTCCTTCCCCGATAACTTCTTGAGTTCTGACATGACAGATACGCGAATGCGAGGGGTGATTGCTGGCATGTAGCAGCGGTGGCTA
CGGTCGCTTGCCGGGAGACGGGGAGGTCCAGATCGTCCGGGTCGTCTTCTCCGTGGTCAGACCCTACCGACTTCATATCGACGTCCTGCGGCTCCGTTCT
TCTCACCGGGGCCACTGTTGGCGTCCCTTGTGCGGCGCGTTGCTCCTTCAGGAAACGTTCCATCGCATAATTCAAGAACGTCTGCAGTCTGTCTGGAGTT
TTGTTCGATCCGCTGGCCGCCACAGGAGCGTCTGCCCTGGGCATCACGCTCGATACACGTTGCGATCTGGTTTGCAACATCGCGGCTCCTGATGGGCCAG
CTGCATTCGCTCGACTCCTTCCGAGGTGTCTGAGTCGGCCATCGAGGTCGCTGACGCGTAGTGCGAGTGTTGGGACGATCCAGTCGGCGAAGCCGATCCG
GGGAGCTGAGTCAGCGCGACTTCCAGCTTGGTCTCGACCTTCGTCTGAGTTTCCGCTTCTCCGACCAGCACTTTCAGTTTCTCGAAGAGCTCCGACAGCG
TGATCTGGATCGCTTCGAGATCCAGATGGAACAGATCTTTCGCTGCAAAGGAACCTGGCGTGATGCTGGCATCCTTCAGCAGGCGCAACGCAGCCTTCAC
AGCGTCTAGCTTGTTCGTCGTCGCTGGTGGCGGCGTCACTGGTCCTTTCAGCGACCCAGGCATCCGCAGCTGTAGGATCTTCATCACCGG