Description :
From Genome Similarity Track
Location :
scaffold_103:63526- 66475
Transcript NameFunction/comments
g3643.t1 lysosomal alpha-mannosidase, putative

Sequence
2949 bases(100 bases per row)
CAAAGCACACGCGGAACGCACGCACCTCAATCGCCTGCAGCGTCACCGACGTACCCTTCACTGGCAGCGAACGAGGAGACCAGCCGTACGTATCGTCCGT
CGTCTTCCACTCCATGCCAGCAGCCTCTTCAGCTAATTCCTTCGTACCAGTCAGAACCATCTCTGTCAACTCCGACACCTTCGCGTTCTCCACCGAGAAC
AGCGTCGAGAAGTCCACCGTCACAGGCTTCGACAGCGTCGAGTGCTCGTCCGCAGCGTACAGGTGCGACAGACGGACCAGCAAACACTGCTTCGACAGCT
CCTGTAGCGTCGTCAGACCCACGTTCTCAGGGAACTCGCCCACACGCAGCCACGGCACCTTCGCCTCCACCTCCGACGTCGCCGGCTTGCGGAACACCGT
CAGCGGTCGGAAGAACTGAGACTCCATCTTCGAGCGGATGCTACGCATGCCGTCCTCCGCCGAATCCACGTTGACGAAGAAGTTGCCGCGCACCGTCAGA
CCCTTCGTCACTAGCTTCTTCGTGGTTGAATCGTACACCGCCTCAGTCTCGTTCAGGAATTCGGCGACACCCTTGTTGTCGTCAGCTAGCAGACGCCGGT
GAACCATCACCTCCACCTGACCGTCCACCAGACTCGCCGCCCCCTGTGCGCGGTCCGTCACCACATTCAACTGGTACTTCGCGTCCTTAATGTACGCACC
AGTCGTGATCGGGAAGTAATTGGCCGCCACCGCCTCCTGGTTGTCGTGCAACGTCAAGTTCCACGTGTCCCGGTGGTTGCGGACGCGCTTCATGAACTCG
AGCCCGTTCGAGTCCGTGTACAGCGTGGCATCCGACGCGATACTTTTGCCGGCGTCGAAGCGCACGATCACCTCCTTGCCCTTCTTGTCGCTAATGGGGA
CAGGACCGACGGTCCACTCGATCTCCAGGAATTCGTCGGCGTCGTTCACGCGGTATTCGAGCGTGACCCAGTTGCCGATCTTGAACGCCACGCGCGGCAC
GCTGGTACGGCCACCAGTCGCGGCATTGCTCGTCTGCAGATTCACCATCGTCACGGCTGGCAACGCATTCGTCAAGGAGCTATTACCAGTCACGGGGTAC
GTCCTGTTCGAGTCGGGACGGAACACGTACGCGCCAGACTTCGGACCGTTACCCTGGAATGCCTGATAGTACGCCACATCGAGCGACAGCGGGATCTGAA
TGTTCTTCTTCTTGTTGGCAAGTTTCGTGATGGACCCCGTCCTCTTGCTGATCTCCACTCGCAGCAGTTGATTCTCCAAAACAACCACGTCGTCATTATC
CGAATCACCCTCCACACTGTCAGCACCGGCGTCGGCGTATTCCTCCTGCACATCGTCGCCCATGTCTTTTTGCTTCACCAAGAACCGAGTCGTACTCAGT
GGCTTCAACTCGGCGCTGAATACAAACGAGTTCGGAGCCACCTGCGTCTCGGAGTGCACCGGCAGCGCCACATACACATTCTGCTCACGGACACTGGCGT
CTCCCGACAGCAACGTCACCTCCGCCGATTTGTGTGTGATCGGAATGGACAACGTCTGCACGCTCGTTCGAGCCAACGCGTTGTGCACCAGCACCTCGAA
GTTTGTGTTCTGCGTGGACACGTTGCACACGCTCGTGTTGGCCAGCAAACAGAAATGGTAAGGCTCCTTCTCTCCGATGACGAACAGCACCTCATTCATC
TCCTTCTCGGCTTGGATGATACCGTCGTTGAGTCTCAGTGAGTAGTCATCAGCAACACTTTGCTTCTCCGTTCCAGAGAGACCGTCGTGGTGCTGCACGA
GACCCACAGCACGCTGCAGTGCGACCAACGCGCTCGAATGGTGGCTTTGGTACACGGCGTCAAGCTGGCGAACTTGTTGTAGAAGCGTGTTGGCCACTTG
GGTAAAACGCTTCAACGTTGGTCGACTCGTGAAGAATCCGGACCAGTAGTCATCTCTAGCCGAGCCGTAGGGGAAGAAGTCGTCCGTCTTGACACTCCAA
GTCAACCCTTCCTCACGCTTCAAGTCCGTGTAGTAGGACAAGTTAGAGTACAGCACATTCACACGTCCGTCTTGGTTGACGTAGTGAATCAATTTGTCCA
TGTTCTTGAACCAACGACGTGAGTTGTCGAACTGGAAGTCACACCCCATTGGAATAAAGACGTGGTTGCCTTTAGATGCATCTCCACGCATCTTGGCATT
GTTAACAAACTGCTCCACCTCATCACACACATCATAGTTATGAAGCTCGGCATCATCTTGAATCTGGTTGCCATTATTGCCAAAGTCGAACTTCCCTGGC
GGGCAATAGTGGTCGATGATTTCACCAGTGAAGACCTGCGACGCCTTGCCGCGGGACTTGCTCGGACGCCAAATAAACTCCAGATCCTTGTTCTTCTTGC
GGTTCCCGTAGTCCTGGTAGTCGATGCGCGCGAAGTACAGCGCGTCGAAGCCCACACCTTGAGACAGCAGAGACCCCTGTGTGGCCGAGTGACCGAACGG
ATCGATCTGCCAGCCGATGCGCGGACTGATGCCGAACTCGTCCATGAGCAGCTGATGGCCGTACGCCGTCTGGTCCACCATGGCGATGTAGTGCGGCGTG
GCCTCGTCGTGCATGCACCAACCTCCGTTGACCGTCAGATCCAGACGCCCCTCCTTCACCAGTTGCTTGACGATGCCGCGCACCTCCGAGCCCTGTTCGT
GCCACCAGCGCTGGAAGAACGACTGCTCCACGAACATGAACTGGCGGTTCGGGTCGCGCACGAGCTCCTCCACCGCCGTGTCTAGGATGTACTGCACCTT
TTCCACGTAGTACTGGTCCACCCCCACGAGCCATCCAGGGTCGTCATGTGAGTGCGCGATGAGATGCACATTGAGTTTGCTAGGGTCCACTTGGCCCGAG
GTGTTGTACACGCCGTCGGTGGGCGGCGTCCACTTGCTGGGGTCGCAGG