Description :
From Genome Similarity Track
Location :
contig_25:63523- 65397
Transcript NameFunction/comments
g5782.t1RAW27698.1 hypothetical protein PC110_g15902 [Phytophthora cactorum

Sequence
1874 bases(100 bases per row)
CCCCGTCCTCAAGTCAACCCGTTCGGTGTCTCCTTCCGTCCCGTACATCTTACTCTTACCAGTATCCATAGCCTTGTTGGCCAAGGCATTCGCCATTTTG
TTGTGAGTTCTGTAATGGTGTGTCCAAGACTCCACCTCACATCGATCAGCTAGCTTCATGGTTATCTTGTACCAGTACTGCATCTTCCTCGTTTTCGGCT
TCGTCCGCTCCTTCATCATTTTCAGCTATCTCCGACCACGTGTATTCCATTCCACTCCATTTTGACTGCCCTTGCCAAAAGTCTATGCAGCCCCGTAAAT
TCAGCTACGTTGTTGGTGGTAGCTCGACTACCAAGCGCTGTCGCCGCCGCCCACAACACTACAGGTAATACCTCGGCGCCCTTGTCCTCGACGATGATAC
TCCCACTGCCTCCCGCACCTGGGTTACCACGGGAGCCGCCGTCAAAGAACCCAACCCAAAGCACATCGTTCCTCTTCTCCGGCACTGCGACGAAATCCTT
TCTCCTCCAGTGCCGAAGGATTTCTCCTGCAGCCTGTATCTTGGTATATGAAGCGGTAGTCATTGGGTACAGTCCCAAACGAAAACGCTCAAAGGCTTCC
ACTACACTTGTCTGGTATCGTCTGAGTTGGTCCGCAATCGCTGCAGCTTTTTTCCTTCTGGGTGAAGTCGATCCACATTCCATCGCCACAAAGCGGTCAA
CGTAACCGCGCAACCGAAAGCCCACATGGAGCAAGCACTTCGGTGACTTGATCCCATGGCTCCACCTCCTGCTCGACACCCCATGTAGTTAACCACCCCG
GCATCTTCTGCAACTTGAACCCGAACATTTTCATGATCGCCTCCTCTTGTGTGTCTTTGATTTCCCATCTCATGCACTTTGCACCCTCCCATTTTGCACA
GTAGAACCTCAAGTGATCTTGCGCCTCCTCGCAGTCCCATGCCAAATGTGCCGATCCCAATGTCTTGCTGTTGGTGCATCCAGCAGCAAGGCACTTGAAA
TTATTTTCTTTGCCGGCCCACAGACGAAGCCTGTTGTTCTTTAACCGTACCACCGTATGAGCTTGATAGGCGGTGACGCCTTCCATCCTGTGAATCCTCT
TCCATTTCAACTACTCTAGGGCCCGGGCCATGCTAGCGTGATTCGCCTTCCACGCCTCCCCAATCTGAGCTTCGGCCTTGATCGCTGCTGCCTCTCTCCG
TTTACCAATGAACTTCTTGTAGGACTACCTACTCTGCTTCCATCTCCGCTTTCCAGCCCAAAGCGGCCTCATCCGAGTCAGCCATGGGTGGGGCAGCACC
CAGACGGACGATGTCTCCGCCTCCAAATAGTTGGGACTCACCCTTTGTATCTATGGTAAGGCCACTTAAGCTTGAGAAAGTGAATTGCATTCTGGTCGGC
TATGGGGACCTACCAGCTCGCTGCCTGCTTCCGTGCTGCTCCTTGTCCTCGTGGCGCTGTCGCCCAGTCACATGAGCAAGAAGCGCCTTCGCATTCACCA
CACGTCCTTGCTTCAGTATCACCTTGTCCTTGTAGCGCCTCCCATCGTTTCTTCGCAGCACTGCATCTCCTACAGCGTCCTTCATCACTTCTTGGCGCAC
CGCATCTCCTGGGACATCAGCGTCTCGTTGTTGTTGTTGCTGCTTTCTGCTATCAGCTTTGAGAGGTATGCTCCACAGCATCTGACGACGACGAGACAGA
GGTAGCGACCCCTGCCTCACCGGCTTCATATCTTCCCCGGTCTCTCCTGTCTACAGCGCCTTAAGTACCGGTATTGTCAACGAGCAACCGCTTGGCCGCG
GTAAGCGAAGCCGAGCCAGAGTTGCTGACGTATTTCGAGACCTCGAAGCCCGCTGAGCGGTCGAACCCACCTCG