Description :
From Genome Similarity Track
Location :
Scaffold_473:6352- 7885
Transcript NameFunction/comments
Physo_145091hypothetical protein

Sequence
1533 bases(100 bases per row)
GTACCGCTTCTACCAAGGCAAGAACATGGAGTCGCACCTCTACGAGGGAATTCAGCCTGCTGAGTTCTACGACAAGCTCGAGAACGTGCTCGCAACCCAG
AAGTCTGCCTTCAAGGTCAACATCGCCCTTGGATAGAAGCTTGTCAGCAGAACTGATGACAGCGAGACTCGCTACTTCCACCCGAATATTAGCAACACGT
CTGTATTTAGCACTCCTGTAGCTATCAACAGCAAGGCTGATATTCGTAAGAAGGTGATCTCGGAGATTCGCTCCATGGAGTTGGCTGACAAGCTCAACTA
CCCCAGCTCCGGGTACATGGTGAAGGGGATTACTGGCTTCAAAATCTATATCTACCAACGCGACCATGCTCTGGGTGATGGCGAGGCTGTCATTCCTAAG
GCGATTCGTGATAACAAGCACGTCATCAACTTCCCCAAGACGAACAACAAGTGTGACTTCCACTGCATTGCTTTTCACAAGCAGGAGGGAGCCAAGAAGG
ATCCTCGCAGAATCCAGGCTCTGGTGAAACAAGCCTTCAAGCAGTACTGTTCGTACAAAGAGATCACCTACACTCTGGGTCGGTTCCGCAATTTCAAGCC
TATCGACATTCTCCAATTCGATGGGCTTGAGGAGTGCTTCAAGCTGAACATCAACGTCTTCAACATGGATGTTGAGACGGGCAAGGTTGAATGCATTCGC
TGCTCGGACAAGGACTATGATTCGATCAACATCCTGTCGCACGAGAATCACGCTCTCTACATCACGAACGTTGATATGCTCCAGCAGAAGTACCAATGCT
CTACGTGTGAGATGGTGTTTGTTAGCTCTGATAAGCTACGCAACCACACTAAGAACCAATGCGAACTCGTGAACATCGAATCGTTCCCAGCTCAGCCAAC
CATCTACCAACCCGCTCCGAACAGCATTCGTTCCATGCTGACTAAGTACTCCATCAAGGATGCTGACCATTACATCGATCACTTCATTGTCTATGATTTT
GAGGCTATCCTCAAGCCTACGGGTGTCAAAAACGGAGAGAATACTATCTTCACAAACGAACACATTCCTGTGTCTGTTTCCGTGGCCGACAGCTTGACTG
AGGAGGTGCGATGCTGTGTCAGCGATGACCCGAAGAAGTTGCTCAAGGATATGTTCCAGTACATCAAGAAAGTTGCGGCTAAGATTCAGCAGTACAACGT
CTCGAAGTACGAGTCTTTGCTCCGCAAAATCATCAACGTCCATGGTTTGACTGACGCTGAGGTTCCTGGTCTAGACTTGGGTAAGACGTACAAGACGAAT
GATGTCAATGTTTGGATTCAGAACGGGGAGTTTGCTTGTTTCTTCGATTTCCACAGCAAGCTCACATTCGGTAAGAAGCGCTCGCATTATGGCAAGCTGA
AGCAGTGCATTGGTCAGGTACCAGTATTCGGATTCAACTCTGGACGCTACGACATCAACCTTATCAAGGCGGACCTGTTTGCAGTCATCGGTACTGACAA
CATCACATCAGTCATCAAGAACCCTAGCTACAT