Description :
From Genome Similarity Track
Location :
Scaffold_20:63518- 65634
Transcript NameFunction/comments
Phyke_g1256hypothetical protein
Phyke_g1257ras-related GTP-binding protein, putative

Sequence
2116 bases(100 bases per row)
TCTGTTCCGTTGGCACCGTCTTCATCGCAGGTACTTGTTTCGCATCGAACGGTTTGACATGAGTTCGACTAGGTGCGTTGTCCTCACCGCTTCTACTGGT
TGAGGCTGGTGCTGtagcggcagcagcaccaatggCGGCTCGAAACTGCTCTCTAGGGTTTCGTGAAGCCTCgagtgctggagctgtagCCAAAGGTTTG
ATGGTGGTCGTTGCCGTTAGTTTGGATTCCACCCGTGAGGTCACAGCAGATGGGAAGTTGTCTGCAGGAGATGCATTCCATCGCCGTTTAGAGACGGTGG
TCTtcgcttctccacctccaggcCGAGCGGACAACGGGGCTCGAGGCTTTGAAGTGAGTGTGGTCGGTGCATCGCGGTGATTGCCAGTTGCTGCCAGCGG
CATCTCTCAATGCCAGAAATGCTTGAGCTCAAATCGACTATCTTTATCGTTTTGATGTTCGAACGGCAGTTTGCGACTGTAGCACCAGCCGAGGACAAGC
TTTCCCTTGCAAGGAAACAATGCAACATAGATTGTTTGCTTAATGTCCTGCACACGAACATCATAATTGCTAATAGTGAGACGGTAGAATAATTATTGAC
AACTAACGCGAGCGAATCTGTGtcaacagcaaaatcaaCTCGATCAGGTACATGTACGCACAGGATCGTACAACGTACGCACAAGATCGTACACTGTACG
CACGTACATCAAATTCAACGATGTACCCAAAATAAATAGGTCTTGCCCAAAATGTGGGCACTGAGAAGTCCAAGGCCGCATAACCCACCGacatcatgaa
gaagaaagcacgTGGCTCTTCCTCCCTGCTAGACGGAATAACGAAACATCTACTGACGAGAGCAATGTGTACTGTGTGCACAGGTTCTGCTGATGGGCAA
GTCCGGCTCGGGCAAGACGTCCATGCGCTCCATTATCTTCGCCAACTACTTGGGTAAAGTCATATCggaagtttttttttttctaCAATACTTTTGCTGC
TATTTAACATACCTATATGATCTTGTGCCTTCCCCTGGTTCTTCTTTGACTACTAGCTCGTGATACGATGCGATTGGGACCGACATGTACGCCTGGGCTA
CAGATACCTGCACTTGATGAGGGTCGGGTAAAGAGAGACTGACGCttgtactgctgcttgcagtgGACGTGGAGCACTCGCACGTGCGTTTCCTAGGGAA
CCTGGTGCTGAATCTATGGGATTGCGGCGGGTACGATCAGCAGAGGCTGTTTGCACTACCCATTGCCCTGCTTGCCACtgacttgtgctgctgctgtggt
ggtctTGTTTCTCCTTACAGTCAGGATGCGTTCTACGAAAACTACTTCGAGAGCCAGCGCGACCACATTTTTCGGAGTGTAGAGCTGTTGATCTATGTGT
TCGACATTGAGAGCCGCGAGATCGATGTACGCATTGATGGGCcttggtgctggtgcgaTTTGGGTTGCTTGATCCCTGATACTAGTGCTGTATCTTGTAT
TTTACAGAAAGACATGGCACATTTTGACGGATGTCTGGAGGCAATTGACCAGAATTCGAGTAACGCAAAGGTCTTTGTGCTCATTCACAAGATGGATCTC
GTGCCGGAGGATCAGCGCGAGCGCGTACGTACCGCATTGACTTGGCTCTATGAATACACGATCAACATGCGCTGAGGCATCAAGGTGTGGTGTACTGGTT
GTTGATACGTAGGTCTTTAACCAAAAGAAGGAGATGATCCTGGAACGCACCGGACAATTACCGACAGTCTGCTTCGGCACATCGATCTGGGATGAAACGC
TGTACCGCGCGTGGTCATCCATTGTATACTCGCTGATTCCGAACATGCAGGACTTGGAGAAGCACCTGAACAGCTTTTGCTCTATCTGCAGTGCCGATGA
AGTTGTGCTTTTTGAACGTGCCACGTTCCTGGTGATTTCGCACGCCACGCACACGAATCATCGCGATATCCACCGCTTTGAGAAGAtcagcaacatcatc
aagcagttcaagctgagctgcagcaagacCCAGGCGCAGTTCCAGGGAATGGAGGTGCGCAACTCAAACTTCACGGCTTTTATCGATTTTTTCACTGCCA
ACACGTACATCATGGT