Description :
From Genome Similarity Track
Location :
contig_24:635150- 652885
Transcript NameFunction/comments
g5776.t1hypothetical protein
g5777.t1hypothetical protein
g5778.t1XP_008904654.1 hypothetical protein PPTG_10904 [Phytophthora parasitica INRA-310
g5779.t1hypothetical protein

Sequence
17735 bases(100 bases per row)
CCTCTACGCCGAGGTGTTAGTCGTGTTCATCATCCCACAGAGGCACTTGAACCGAGCAGGCAGCATTTCTTCCGGCATCATGAAGGTGGACACTTCAAGG
GTCCAACTAAAAAATCCAGCTAACGTTATAGTTTACGGTCATTTATAATCCAATCGGATTACGGCCCGAAAAAGGTAGGTGCCTTTATCTAGACATTTCC
ATGCTATTTTCCTAAAACCAATCTTTCCGGGCCGTGGGATCACTGCGAAAAAAATTCAGTCGCCGACACGTGCGGATTAGGAGACCCACGCAGCTCTCAA
TGGACGGCGACGGCGCGGCAACGCCCGCCGATACTGCGCCTCCCGCAGCGTCTGCACAAAACCAAGTTGTCCCCAGCAATGGCATATCCTCCACGCCTCC
CAATGGCGTCTCAAGCACGAACGGATCGTCCGCCAACGCTTCAGAGGCTGCGGACACGTTCCCAGCCCCGCTCAAACCCAACCCGAAGCCTCAGCTGCGA
GCGCCGCCCAGGCGACTGCGAAGCGGCAGCGGGAGTGGCAGCAATACAAGCTCCAGCGGCGTGCGACGCGAGTCCGGGACCCGTCGACCCGCCAGCGCCA
ACATGGGCATCGTCGTGGGTACACTGAGACGCAGGAACCGGGTGACGCTACGCACAAGTTCCTTGTCCGACGAAGAGGCCGACGATGTGGTCACTGCGCC
GCCCAGAAGCGGTGCGAGCTTGGCACCGAGACGCGCCAAGAAGCAGACGAGTCTGCGCAACATGGCGTCGCTCGTGCGCTCGCATCTGCGCAGCTCCAAG
AGTCTCTCGTCTACTAGCAATGGCAGTAGCAGTGCAAGTGGAGAGGCAGACTTGGACGCAGACAGTGGAGGACCAGGACTAGAACGCAGCAACTCGTCGT
TTGCGGGCGTCGCGCAACAACTCGTGACGTCCCGACGTGCAGCCAGAGGGTTTCTGTCCATGTGGACAAAAGACTCCACGGAGACCATGCACGTGTATCG
CGGTATTCACATGGAGAAGAAGAAGCTGGACCTCGTGAGCGTGGCCTCCGAGTACAAAGAGATCAAGCGTCGACAGTTCTACCAAGAGCTCGTGGTCTAC
TTTGTCTTCTTGATGGTGCTCTTCTCGCTGCTGTCGTGGCTGCCCGTGCAGGATAGTTTCCACCAGAATGATGTCGTGGGCGCCCTAACTTGCCGGGAAG
AAGGTGAGTGCGAAATCAAGACCTTCGCTGACATTTACGAGTTCGCTGGGAAGTTGAGAGAAGCCGTGTGTGACCGAGATGGCGTCACGGCGCAATGGGT
TCGTGTTGGTGGAGTGGGTTTCAGGCAGGTGCGCGTTAAAGAACAACGCTGCCGCGTCTACGAAGGGTGGGACGCGCCGTGCTACCCGTTTTACAGCCCC
GAAGTGGAGCAAACGAACCCTTTGCTAGGCGAAAATGGCACTGACCGCTCGTACGTGTGGAGGGATGGTCTCGGCGAATTGTCACCGGAGCTTTACCGAT
CAGTTGTGGACTGGTTGATCTACGCTCCCGTAACGTCCTATGGCTCGGGTGGCTACGCTGTGGATCTGTGCGATCTAAATGATGTGAATGAGCTGCAGAG
CGACAACTTCCTCTCTGAGCACACGCGTGCTGCAGCTTTCAAGTTCATTTTGCTGAATCCGGTCACCCGCGTCTTTACTATTGGAATGCACGTATTTACA
GTGGATCCGTCTGGGCACCTAGACCACTTCGCACACAGCTCACACGTGCGAGTGATTGGGCACGAAAAGTCTGAGCAGTTTGCACTTGATGATGTCGAGA
ACAAAGCAACTATTCAGCCCAAGCTTCACAAAAGGATCTTCAGTGCTGTTGGCAGCACGCTTTCTTTGCTGCGTGATGCGTTTGATGTGCGCGTCTTACT
CTGGGTAGCGCTGTTGCTGTTCTTCATTACGTACTGCATCGGTGAGGCTACTGAAATGAGTACGATGGGTGCGGCCACATACCTTGGGTCAGATATGTGG
AATTTGTTCGAGCTTACACACTTGGTGGTGTTGGCAGGGATGCTGAGCTATATGGTGCACTACTATATAGCTTCAAGCAACTTTGCACTCCACCTCGAGG
AGCTGCGTGAAGGGCGTGGTGTGGAAGAACTGAGCCACTCGAATTCTCAGGAATTGTTGACAGTGTTCCAGCAGCTTTCCGACCTTGCTTCACTCGGATC
TGCTATTAGTTTGCTCAAGGTGTTCAAGTTCTTGCGCATGAATTCGACGCTAAACCTCCTTTGGCGAGTTTTGGGCATGGCTATGCGCGATCTAATGGGG
TTTCTCGTCATTTCAACCTCATTTTCCTGGGTTACTCGGCTATGGGCAGCTATGCCTTTGGTTTTGCTCTCGAAGAATACTCAACTATCAGCAAGTCATA
CGGCACTTGTTTTCAAATGCTTGCCGGCGAGATGGACTATGCTCGATTGCGCCAGGCTAACCCCCGTGTTGCACCCCTCTTCATCGGCACCTTTGTTGTC
TTGGTCTTCCAAATCCTAGTCAACATGTTTGTTGCAATTCTGTCGGAATACTACGAAGTTGCAAAGAACGACGAGTCTGGAAGTGGTGATGACGTCGAGT
ACGATGTTCTTGCGCGAATCCGCAGCTTTGTGAGTGCATGCTCACCGACAGTCGTCGTGCCGAAGGACCATGGAGTTATCCGTCTCATCCCGTGGCAACA
GGTTCGTTTGATCTCAACAAACCTTGTCGACCAGGAGGAGACCCGTCAGCGTGTCAGAAAGCTTTTTCGCGGGGCTGTGTGGCGTGTCGTCGCTCTGCTG
CGCTTCGGAATGAAGTTTGATCGCCGTATTAACTTTGGTGACCGCAAGACTAGCAACGGCAGTGGCTCTCACGGCGGCGTTGGTGGGGGCTCCAGCAATG
GCAAGGATGAGCGCGAACTCGTATCGCATATCCGCCTTTCGGAGAACTTTGATCACAAGACTATCAAGGAAATGATTCCGATCGGCATCACTATTCGACT
GCAAGGGGATTCAATTCTTGGCGATGGACTGGCGCTCAAGGTTGTGCACCACAGCAAACTGTCGGTGGAGTGTGTTGTTCTTGGTCCTAACGACCCTGAA
GGGACTGCTAGGGTAAATTCTGCTGAGAAAGTTGACGGCTCACCGAATGCATTCGCACCTCCCCGCTCAATATCGTCGCTAGGGTCATTTGAGGACGAGT
CCGATCTCGATGATGGTGCTCCGCGTGAGCGTATTCTTGAGCTGATGGGTGGCGAAAAATTGCGGATCCCCAGGCAGCGACTGGCAGTCCATTTGTGTCG
CACCATGCTGCAGGAGCTCAAGATGGGGCTATTGCGTGCAACGAAGCTGTGGAACTATTCGAAGGATCACATGGTGGATGACTATCACCTCGGTCTGCTA
TTTGATAGTGTTCGTGCTGATGGTCGTACCAGTCTTCGTTTTGACGAGATCTCACGTATGCTAGACCTGTTCCTGCGCAAGGATAAGCGTAAGGCACTCT
GTTCGCAAGCAGAAGTGCGGCGTGAGGCTCTTCAAGTGATGTACCGATTCCGCAAGTGCCTTATCGATATGCCATCACGTGAGAAGGAGGGTCACAACTA
CCGCCCGAAGCCTGTTGACACGTCCAAGGTGGAGCTAGGTCACCTCGAGCATCTTGGTGATGTACTGGCTCGCAACTGCCACGATATGTGGGCGCTCGAG
CGCATCAAACAAGGGTGGCAGTACGGCACGGAGCGCGATGACAAGAAGAAGAAGCACCCGAACCTTGTGCCCTATAAACTACTTTCCGTGGAGGAGCAGG
CCTTCGACTACCGCTCATCTATCGAAACGATCAAGACGATTGTGTTTATGAACTACGCCATTACGCGTGCGAACCACCAGCGCTCACACAGCGGCTCCTT
CCATGACTCTGTTTCCCGGTCAGCGTCGATGATGTCAGACATTGCTGAAGGCATGGGCGGAAGCAACAGCTCACTGATCAGTGGCGGCTCGGAGTCTACA
AGCCCACGTGCTAGCGATGCCGCTGTTTTCGAGGAGCTGGGCACTGCCTCTCACCCCGGTACGCCTGCTAAGCCTGTGCCGTCACTGTTGCGCGAAGCGA
TGAGCTTCCGCCGCAACAGTCTCATGGGCGATTCGCCGTACTTCACGACGTATGGAGATGGAAATGTCGAGGTCTATCGGCCTCTTCCTATCGACACGAC
GACTGTGGAGCTGCCTCCTAGGCTCTTGCGCCTTGTGGACCTGCTGGCCGAAAACGCACACGAGGTCTGGGCTAAGGGACGTATGGATGAAGGTTGGACC
TACGGCCCTCAGCGTGATGATGGTTCGAAGAAACACCCGTGCCTTGTGCCCTATGTGTTCCTCACGGACGATGAGAAGGAGTACGACATCAACATCGCCA
AGGAGACGCTCAAGACTCTGATCGCGATGAAGTTCACAATTCTCGACCGCTCCAGCAAGTACTAATCCTGCAGCGATTTCTACGTTGGTATCGACACAGG
TAGCATACACGTATGCAAGCTTGGGGCCGCCACTACTGTGCGCTTTGGTGCATGGCTCGCTAGCAATATTGAACACTTGGTTTTACGCCAGATGCACTGC
ACTTCTTGAGGTTCTTGCGGAGGGTATGGTTGGTTTTCGCGTTTTACTTCGATAGAAACAGAAGATTGGCTTGGCGAGGTCCACGGATTCCGTAAGAGCA
GAAGGTGAGCCTCATTGCTGCGTAGCCTCATTTCTGAGTAGTATCATAGCATTTGTTCGATGCCATCTAACTCATATTGTCAGTCGACAGGCATCTGAGG
GGCAGAATATGAGCTCAAGTGATCATCCTAATATGCTGGATGCATTTGCGTGGTTTGTTTAATATGCCGCCGATGGCTAGTGTCTGGAGCGGGGAATTGA
TGGATACATTGCATATGCAATGGAGTTACTCCTCATCAGGGGCGTCCATGAGAATGTCGGTGGCTGCCTCAATGGTGAGGCAAAGGCGAACAAGCTCGCG
ACGCACGGTCATTGCATTGCCGCGCTTGAGTTCATGCGTGACGCCAGGGAAGAGACTCACGCGATAGTCATCCCACTCGGAAATGCCGTACAGCACCTGG
AGACAAAATAAAAGAGGGTGCAGAGGATTAGTGGGGGGGGATTCATGAGGGTTCCAGCTTGGAAAACAAGAAACTTACATTCTTGATCCAAGGCATGTAC
GTCAGCCCCGAAGGGAGCAAGAACGCACGCTGAGCACGAAGCAGACGGTTGTTCACCTCCCGTACGCGACTGAAGTCAAGCTCTTCGTTCGAGATGACAT
TCATTTCGTGACTGACGCTGAGAGCAGCAGCTTCGAAAGCGGTGGTGGCATTGTGCAGACGAACGAGTGATACCGAATCGGCTAGACCTTCACGTCCAAG
CGCATCCTCCAAGAATGCCTCGCCACGCCGCAGCTCACGGGATAATTCGGTGAAATCGTACTGCAGAAACTGCGCGTCAGTGAAGGACAGGAGGATGCTG
CCGTAGAGCTCAGCAGCGGCGCGGTGGAATGCAAATTGGGGGTCAGCGAAGTGTGAGATCCAAGCAGGGGTATCCGCGCCCGTGTCTCCTACTCCAAAGT
AGCCTCCGTCAAAGCCAAGCTCGAGCGACGGTATGCCCAGCCGCCCAAGGAATGGGGAGACACGTCCTCCGAGGGAGCGATCCATCGGTGGCAGCTCCAG
CTGGACATCGCTTGGGTTCTTCTTGTTGGCATCGTCAAGCCAGTATGCGAACACGGAGTTCCCACTGCCTTCAGGGAGCTCGTTGCTTGAGAAGGTAGCA
TTGATTGGCAACATGTCAAGATCGTCTTCATCTCGGCTGGAGCTCCCGGCGGCAAAAGCTGAGGCGCTGGATAGGTTGTGGAAGAAAAAGCTCGCAACGT
CAGGGAAGGTCTGCTTCTTCGGTTGAGCTACAGCAGTCATGAGGTAGATGTTCTTGCGGATCGTAGCAGAGGCCTTGCAGCGAAGTGCGCCAGCGCCGCG
CACAACATCATCCAAGTGCAGGTAGACGACACCACGCCCAGCGTTCCCACTCCCGAATCCTGGGTACCGGTCGATCCAGTGCGAACTACCAACCGAACCA
AACTGTTCGCCGCCAAACGAGGCGAGGACCAGCGTGCGGTAGGGGGTCCATCCATTTGTCAGGAGAGTGCCAAGAGCTCGTGCAACCTCCAGGAACACCG
CGTTTCCCGATCCTGGGCTAACCGCGCCGGCATTGAGCGAGTCACGCGGAGCACCCACGAGCACATGGCGATCGGGTTCGCGAGAGCCGTGCACCGTGAT
CACGACGTTCCATGTCGTTGTCAGCGAGTACACATTGCGGTTTGTCATTTGAACGACAATGTCCGCTGCTCCCGATGAGGACGTGGCGCCATCTACTGGG
AGTGTGTACTGTACGCTCAGCGCACCACCCTCCCAACGCGCCCCGAACACGTCCGCAGCTTTCACAGACTCGAGGTCAGCCACTTTGTCAGCAGCACTTT
CCATTTGAGCGAGCAACTCCTGAGCCACCGCGGCGCTGATGGGCATGCTGACAATGGGCGGGAGGATGTTGAACGTGTTGTTCGTCGAATAAACATCGTC
GACGGAGATGCGATCGGCGTTGGTGCCCATGGGCCGCGTAGCCGAGAAGCCTTCTGGCATGGTCGGATCGCCGTCTCCCATGTAGACGTTGCCGAACGTT
GTCGTGGTGCTGGGACGCCATGGCCCATCGGGTGCTGTGGGTCCTCGAGCAGCTCCATCGTCAGCTGGGTCACTACACAAAGGCACAGTGTTAGTGCACA
CAGTTGCTGGACGAATACACTCGAGACGCTGGGCACTTACGTGTATGTGAGCACACCGACTGCACCGAACTTGGATGCCAAGACAACCTTAGCTGGAAGA
GATACGTCACCGCCCATGCGAACCAGCACGATTTTGCCAGCCACAGACACGTTGTTCAGTGCCAGAGCATGGTAGTCCTCTGACGCGCCAAAGTGAGCAT
ATACAATTGCTCCTGATACAGTGCCGTTCTTGGAGTACAAGTGGAACGCAGCGTGCGGCTTCGTCATGTTCTTGCCCTTTGCCTGTCGCTTCGCCTGTCG
AGCTGCGTGTTCAGCTACGAAGTCGTACGTGGCCAGCGTTTTGTTGTCGGACTGCTGAAGAATATCTAGGGTGAGCGTCTCAGGTGCGTTGATGAGCATT
TCGAACTCGTCCAGCTTGATGGAGCTCTCTGCAAAGCCGAAATCAATGGCTTGTGCGCGAATGAACTGTGCCATCTCATAGTCTCCGGTGGTGCCTGTGT
GTCGAGATACCTATTGTGTGCACAACCACCCAGTTAATGATCAAAATGCAGATGCTCGCTGCCGTCAGACGTACGTTGGTGTAGAACTCGAGGTTCTTCT
TGAATCCATCGGCCGATGTGGCAGCGATGAAGTGGTGTTGGATGGCTGGCGTCGAGCTGTACACAAGATAATACAGGCATCACCAGTTAGTGTTCGCCTG
CATCGGCATGTATCTTCGTTACGCAAGACTTACCCGTAGTTCTCTTCGTGTCCGAGAATCCCCAAGAGCATGACGCAAATGGAGCTGGCAAGAAAGAGTG
CCGTCACGAAGGCGATTCCGACGCGGCGACGAAGCACAATCTCCTCTTCGCTGATGCCTTCGCTCACTTGGACCTCGCGCGGACTGTCGGCGTACACGTT
CGACCTCGTCAACGGCACCTTGGACTCGTCGCCACTGCTATCGCCCTCATCGAGGTCGAGATCGGGGAGCACCTTGAGTGCATCGCCCTTGATGATGCTG
GCTCTGTCTTCGGAAGAGCCCATTGCGACCTCAACTGCAGCTAGACGTTGTTCTGAGCTCCGCTAGCTGGTTTCAGCAATGGGTGCTCCGCCAAGACCAA
GACTGCACTCGATCGCACAGCCGTCTATCCTCGGAACTGCACTACGCACGCTATTTTTTGCTAGCAAGGTGAGATCCTGCGCCATGCTGACAATGAGGCA
GCAAGAATAGCATCCGGCCAGCTCCTACTATTCCTGCTTGAGCGGGCATCATGCTGAGACTCGCCCGCTACCATCTGACCGACTTCAACTTTGGTCGCCA
CAACCGGCTTTCTGCTTGGATCAAGTCGGTTCCGAAGGGCTCACTTGGAAGTGCGCTAGACACGCTGGAGGGAGTCCAAGCAACAGGACGATCATACTTT
TTCTTGGGTTTACATGTGCCACGCCTCTGGTTGGCGTGGCACCGTCCTCTGCTTCGTCGAGGGACACTCGCTCGTGTCTGATCCCCGTCCTAAAATCTAC
ACTAGTTCACAAGTAGGAAGGCGAGGCCTGCCTTCAAGTCTCGCGAGCTGTCCAGCAGCGTCGCGGTTCCTTCCTCTCCTCTTGTTTATTTTTCTTGTCA
TGTTTCTTCCATCAAAACACTCACTCACTCACCGCGCGCGAGCTCCACTCCGCTCCGCTTTCAACTAAAGCAGCTGATGCTTCGCACTTTCTTCTTCGTT
TGGCCCTCGAACATGCTCTCAGCCTGGCGAGTAGCCTCAGCCACGATAGCATCAAAGAAGGCCACACCGTCCTTATCCCCCGACATGCCCTCCTCCACAA
CCGCCACCGCCTTGGCAACAACCAATTCCAGCTGCGAGGGCGACGTGAAGTCGCCTTCGCGCTGCAGCAGACTGCCGATCTCGAACAGCGAGAACCCGGC
CTCCGCTCCACGCTTCAGCACCGCCGTACACACACGCATCGTCGTCACGCACTCCTCCTCAATCCCAACAGCACGCAGCACGGCCGCATCGCGCGCTTCG
TCCAGCGACGCGATGTGGTCGAGCTCAGCACACGTAAACGGGAACTCGGCCTGCGGCCACTGCAGCCAGTCAAACGTCGCACCGTCCAGGTGCTTGTAGG
ATGGCAGGCAAAAGCCGTGGTCAATCGGCGTCATACCGAAAGTCTGGTCGTTGGGCCGGGCGCTCAGCAAAATGTTGCCGGCGTGGCGGTCCGTGTTAAA
CAGCCGCACGTCCAGAATGCCGATCTTGTGCACCTCAGGGATCGCGAACTTGAGCGTGCCCATGTCTTCAGCTGAGCATTGCGAGGCCACGAAGCGCTGC
ATCGACCCTTCCTTCTCCTCTCCATGTACACTCAAAACCATCAAATCCGTAACCGGCACGCCACTAAAGTTGCCGTATGCGTTGTCGAGCAAATAAGCGG
CGCGTTCACGGAGCGCGCCGTTTCCAACACGGAATCCCCTGTTCACTGGGTGCTCCGTGACGCCCACCACCGCGTTCTCCTTCACGTATCCTCGCGGGTT
CTTGGGGGCCATGTACTCTTCGTCTCGCGGCTTAAAGATCCCCATCGGGTTCATCTTCCTGGCAGAAGACGTGGTCGATACCGTCGTCAGGTAGTACGCA
CCGCCGCATCCGTCGCTGGTGATCTGGAAGCTGCTGCCTACGTCCGCGACCATGCACTTCACCTGATCAGCAAAGCGTTCCGAGGCTTCGGTGGTGAGCC
ACTTGGCCCCCAGAGCAGCAGGCAACTTCGTCTCCGACTCGCTCTTGTCCACAATAGGTGCCTCGCTGTCGCGCTTGAAGGGTGACGTGCAGCGCAGCGG
CGACAGGCGGGACTGCACGATCGGGTACAGTCTCGTGACCACGGTCTGCTGTAGCAGGCCCTTGGCGTTCAGCATGGCCGAGCCGTGCACCCGCAGGCGG
CTGAAGCGACTCGTGGCCCGCTTGTTGTTGCTTGCCACCGTCGCTGTTTCATCCGCCTTGTCCGAGCTCGCGCGAAACCAGTCAGTGGCGCCCATGCTTC
CTCTCTGCTTTTCGGTCTCTTCTGGGCGGAAAAAGTCTCGGGGGCGGGGCTTTTTATCCGATCTGCTCGTAGGCGAGGAGGTCAGAAGAGAGGAAGGCAG
AGAGGAGAGAAGGAGCGTCTCTCTGGATGGAGGCTTGGAGAAGGCGGAGGGCGGAGCTTCAAGCGCTGCGCAGGGCGGAACGACGTGCGGACTTCAGTTC
AATTTGCGGAATGGCGACACCACGCTGGAAAATAGCCAGCCGCATTCTCTATATCATGGTTTGCAGGGACTGCATAAGTAAATGCATTCTAGATAAGAGG
TATGCATTATAAAGAGATTTATTTGTATAGAAACACTTGCAATAGTGAATGGATTTGTGCTATAGATAATGCAATTGGGAGGGAGCGAGGGACGGGCGGT
GCAAACGCGTGCATTCAGCTTGCAGTTGTGGCAAGCAAGACAAGATCAAGCGTTGCTAACAGTTGCCGAGATTTCGCGAGCGGCGCACTGCGACAGAGTG
TGATTATGCCTATAAGAGACATACTGTGTGACGAAACGACTCGCCGTCCATCATGAACTTCATGGGCACGAGCGTCTTCCGCAGTGCGGAGACTTTAGTA
CGCGCTAGCAAGGCCCCACATTGCCGCACGCTTGCCTTAAGCAGGACTTGACAAATTATCAATATTAATAGTGTAGCTGCGAATAGTACATGTAGTATTG
TGCTTTGCAGCTCTTTGGACTCCAATTCGTACGCTTTGTCTTGCACGATACAACAATAAAGCGTACATGCTTTATACTCTCCCAGTATGTGCCTTGGTGA
TCTGAAAACCCTGCCACGACTTGTGGTTGCTTTGGCACTTTCTAGAAGTGTGCCTGAAACACAAAGTCTCTATGCTTTAGCGCTAAGTACGAGTACTAAC
TACTGCTGGACAAACTGGTTGCAAAGCACAAAAAATATACTTCGAAGTAATACGTGTTCTGTGCTCATAGAAACTTTCTCAGCTCGGTGCTGTATCCAGT
AGGCACAGATCTGCGTGGACTTTGCCAGCTATTAATTGTGATTGCTACAGACTGTAGCCTTGCTGCTCTGCTACTTTCGTAGCAGACGCGCACTGGATAT
GGTCTTGCCACCTAGGGCCGGCAGTACTGGCACCTTTCCCAACAGCTACTATAGTAATAGTACTGTCGAACAACGTTCTGTCAACTACCGAAATGGCTAC
CTTCTTACACGATCTCCATAACTGTCGATAAAAGTTCTCCCCGAGCGCGTTCGAAGAGCTCCGACCTAGGCAAATACGAGTTAGTGGAACGGCTCCAAAC
CCGACACACGAAACCACTGGCAAAGGGACCAGGACGCATTGCCAGCCCGTCAAACCATCAGCAGTCCTCCACTCCTCCTTCGACTAGCCGTCGGCAACAT
GACGCACAACAATGCACGGTATCGTGTATCACTCCCTCTGGAATATGTCTGCTTCGTCGTGAGGACGCCTCGAAGGCTGGACACGGTGGATAGAATCATC
GCCAGTACACACACAGTTGCGTGAAGACCTCAGCGCCATGGTCGCAGCGCTGGTATTCCAAGATCGTGAATGACACTCCACACGTTGTTACCATTGAGGC
ATTTGAGTGGGAAGCAGTGATCTGCAAGCTGCAACTTGCAGTTCACGTGCGAGTAAGACGACGAGAATCACACAAACGCGAAAATGGGGTGGCATGTAAG
CAGCAATTGCGCGGTCTTGTTATCCATGGCGGTGGGGATCGGTGCTAGTTCAACAGTGCTATCGACGTGACAGGCTTTACAGTAACAGTAGAATGGAAAT
CGAGCAAAAGAATAGTACTACAGACAATCCTCTCGGTCGTGATATCCTGAGTAGTGATACCCTCCACGGAGAGATATGGGGAGGGCTCCCGATGACCGTC
ACCATACAAGCACGAGTCAAATATACCTCTACCCTCTAGTTACTGGTTTGTGATACAAAACACGTCATTATCACTATTCAAAGGTGCTTAACTATTGCTA
AGGTCCATTTGGTGCAGGACGTCCGAAGAAGTCGAGCATCGACTTTTGCTGCTTGTGGCCTTGTCTACACGCAAGCTCCTCTCTAAATACTCGCTGCATC
GTTCGAAGCCCGATAACGTCCCTTGAACGGACCCCATCGCACCGGCGGTAACGAAAAGTTGTGCTATCCATTGAAGACGCTCCTTCAGCTCCTCTGTGGA
CAGGTTTCGGGCGTTGGATAGGTTGAAGAAGTGCTTTCTTCTTCTTCGTCCTCGATACCGCCATCACCGACATCTTGACCGCACCCATTCTCGCGCTCTG
AAGACTCGACCCGGCAGAAATCTTCGTCCGTTGGTTCATCCGCGAGGATGTTCTCGTCCGGTGGGTTCAGCAGCTCTTCAACCGACATCGGATTCGAGGG
GTGGAGACGCGTCAGCATCTCTGCCAGCTCGTTCACGATGTCATCCTCCACGCCCGGCTCGGCGTACTCGCACGTGTAGTAGTCAAGCAAGCCAGTCTTC
TTCCAGCAGTTACTGAAGACGCTGGGAAGCAGGGCGTTCCAGCTCTCGATGCTCCACAGTACTGCCTGCTGTACGTCGACGCTGTAGAGCTGTTAAGTTC
AAATGTACCAATTTTACGGCACATTTCTGCCTTGTAATAACTCCAGCGAGTGATAATGTGGTGGTTCCCGACGCTATCACAAAGGAGAGGATTGTCTGTA
CATAACAGTAGTACTATTTTGTGCTGGTGAGGCGAGTTACTGCCGATCCCTACATGTCACATTGTAATCTTGCGGGCTCCCAACGTGAGACCTAACACCG
TAAGGCTTGCTGCATTCGGCGAAAGCTGCCACCGACTAATCTGGCGTCTGTAGTCGTTACGCGGTATTATACATGTAGTGCCAGCAAACGCATCACTGTT
GATGCTGGGGGGGGGTCTCTTCCGAAATGGCAATATGCTGCATAGCCTGCTGCGACGCCGCGCGCTGGGATACCAGTGCTGTACCGGTTGGGGCTGCTGC
CTTTGATTGACGATTCGGACCTGCAGCCGAGCAAATCGGCGCTGAAAATTGTAACGGGAAACCCCCGCTGCATGGTGCGCGTCCTCGGCAGTGTGAGTCG
ACACTACTATAATACACCAACATGCTGCCCCTGTACCACCGGAGGTGGCGCTGCACATTGCCATCGGCAGCTGGCCCTTTGCAGGCGTCAAGGCGCGCGA
TCCTGTCGCGCGGAGGCGCCTGTTGGGGGCTCATTTGCAGCTGTTGTTCGCATCCTTGTCCTCGTCATATCCAGACTTGGCGCCAGAGAGAAGCCGCGGC
GTGGCACGAAGTCAACCCGGGCCCTCTTCAGCTATCAGCTGCTGCTGGCAGCGCACCATGCCGCGCAGTGCTCGACGTGTGCAACGCCCGAGGCGCATGG
CTTTCTAGACCGCTGCCACCTCATGGGCGAACCGACAAGCTCAGTTGCTATTGTTGCTAGACTATGCCGTCGAGCGCTGTCAATGCCTCAATGCCTCATC
CCCTGCCAGGTGTCAGCGATTAGCAACTACCGTCCGACACCGGTCTAAGTGCGAATGGGTTCGCTTCGACCCGGTGTGCATAGTATGGTCATCATATGGT
GCCAACCGCTTCGATTGGCCGAAATGCATGGTCATACAGCGTTTCTACTCGCTGAAATGTTTGCTAGGAGTTTTCGCCAATCAGACGTGCCCCACTACCC
GCCCGCCTGGGATCACAAAGCCCGCGGCCCATATTGCGCCGATACCGGTTCGTCCATCATGAGCATTGGCCTCCCTGCCTCGCGCTCTTAGCGCCATTCC
GCGCTTTCCCGTGGCCTGCACAAGCGTCTTGTTGTATATTCCTATCTGTCCATAATGTCCATCCTCGATGTGTGTGCGTCCCCCATGCCCTTCGCGCTCC
CCATGGAGTGCGCCTCCGAGTCGCTCGAGGTCATCCAATGGGCGCTGCTCAAGGAGAAGCACTACCCGGCGCTGCGCAACCCGCGCTACCTCGCGGACGT
GCAGCGTCACGGCATGACGGCCACCTGGCGCCTGCGCGTGTGTCGCTGGATGTTCGAGACCGCCAAGGAATTCGAGCTGCAGCTGGACACGGTCTGCGGC
GCGCTGCACTTCCTGGACCAGTACCTGAGCGTGCACTCGGTGGACCGCGTGACGCTGCAGCTGCTGGGCATGATCTGCATGTGGACGGCCAGCAAGATGC
ACGAGGGTAAGCCCATCCTGCTCGAGGAGATGGCGCTCATGTGCGAGCGCAAGTTCTCGCGCGCGCAAATGATCGACGCCGAGGCGCAGCTCGTGCGGCT
CGTGGGCTTCCGCTTCAACCCCCCGAACGTCCTGACCATGGCGAGGGACTTCGTGAACGAGCTCCCGTTCGACGACGACCAGCGCGCCAACTGCGTCGCG
TCCGTCTTCAACGTGCTCGAGCGCGTGCTCGAAGACGTCTCGTCCCTCGACTGTTCCGCCTCCAGTCTGGCCAAGGCCGCGGTGCAGCTCGTGGCCAAGT
CCGAGTACAACCTCACAGTGGCACAAGTGCTCAAGGCTCTCAAGTCCATCAGTGTCGAGGAGGGTGCCTACCGCGCAGCCTTCAAAATTGTGCGCGGCGC
CTACTTCGGTACGTCCCCCGCCTCGACCAAGACCCAGATATCACAAGCTGTCGCTGTGGAGGCCATCAAGTCGCTCACGCAGAGCCCCACGGCCATCGAA
CAAGTCGCTGTTTTCGCCGACGACACGCCGTCGCCCCCCGACGTGGATGACTCGTGCCTCATCTGTACCGAGACGCTGTCTCCGTCCCCATCCCAGGCAT
CTCCTGCGCCCGTGCGAACGGCTGCATCGGCCTCATCAACCATCGGAGTCACTCGGTCTGCGCCCTCACCAACGTGCATCGAGTCCGATACCGAGCGACA
CAACAAACGTCAGCGCAAGCTGGACATGTAGACACAATAGGAATCAACAAGACTGTAGAAAGGAAGGCGCTAACGGAGCCAAAAAACAAACTAATTTATA
CTCTACGCCTACTTCCTAGTCACTGATCTCGATGCAGGTCACACTACCGTCGCTGTCTTCAGCATTTTCACCACGACGAGCGCTGCTGGCGTTATTTTGG
TCGTCCTGCTCTTCTTGCTGCGTGAGGAACAGCCTCCTGAGGTCTCCTGTAGACAGCCGCGTCTCACGTAACCGGTTCTTCTTGGCGGTGGAGAGGTCAT
CGCCATCGCCCAAGAATGCGGCCGTAAGCTGGCGCTTCTTGTTCTGCAAAGCCACCACGCGCTCTTCAATGGAGCCTTTCACGATGAAGCGAACGACACG
CACGTTCCTTGTTTGGCCAAATCGATGAGCACGATCGACAGCCTGCCGCTCAAGGCTGGGGTTCCAGCTAGGCTCCGTGATAAACACGTGCGCCGCAGCA
GTCAAATTCAATCCGAGACCACCCGTGCGCAGGGACAATAGTAACACGTCCAGTGGTGGGCCAACGACCGGTCCAATGCCGAGGTTGTCTTCGTGCTGCT
GGAAATTACGCACGACTTGCTCCCGATCCTTGACTGACATCCTTCCATCCAGTTTAGCGAACGAGATGACCTCATTGCCCACCTCCGATGCATCTTCAAA
GGATGAAACGCACTTCTCGCACCGAGAGTTGTGAGCCTCAAGGCGCTCCGCTATCACATCCAAGAAACTTGTCCACTGTGAAATCACCAGTACACGCTCA
CGACGTGCTCGCACCTTCTTCAGCTCCTGCATTAATGCTGTTAGCTTCGTCGATTCCAATGGACCGCACCCAGACACAGCATTTCCATCAGCGCGGCGTT
CTTGAAGCCGCTTCAACAATGCTGCTTCTCCAGAGGAGAACGGAGAAATGCCGTCCCATCCGTTCCCTACCAGTGCTTCAGCACTTGCTGCCCGAGTCTG
CACTTCAGCCAATGGGTCTTTCGTTACAAGTGAAGTTGCATCACAGACCTGCCGCAGCCGCAGGATGAGCTCAAAGACGTGCATGAATAGCGGGCGCTCG
TCCCCGTCGTTGGCTGGAGTTGTGACGGGAACACGATGAGCTTGCTTCGACTCCTTGGATTGCAGATACCGCAGCACTTGCCTTTTAGTAGAGCGATGCA
GTAGCATATACAAAGCGCGCTCCACATCTGAAGCAAAGTCAAGCTCGATAAGCTCTTCAGTCTTCTCCGGTAAGTCCAAGATAGGAGCTCTTGAGCGTGC
ATCCACCGCGGATTTGAGTCGGCGCATTACTACACGCGGCACCAATGCTCCAAGCTCACGTTCAGAAAGTGCGTGCGCACGGTTACCAAGCCCAGCAAAC
TGCAGTAGAGCTACAAGGTCTGCCGTTCGGTTCTGGATGGGCGTGCCAGTCACACACCAACGGCGTCTACTGCTAAGAGTGAATGCAGCTCGCGCTCGTG
CGCATCCAGCATTCGCGATAAGGTGGCTTTCGTCAAGGATGACTCGGAACCACTGCAACTGATGCAGCTTCGAAGTTACCACCGGTCTCTTCGACTGTGG
AGTAAGACGTGGCGCTTGATGCCATCCATCTCCTGAAGCAGTACCATCGCCGTTGTCTTGTTCGCCATCTCCATCACTGTCCTTGTCTCGAATTTTGCAT
TCCAATAGGCGGAGAGTATCATAGGTCGAGAGCACGATATCTGCCCCCATAAACTGCGTTGCAGAGCGGAAGCTTTTGCGCGTGGCACCTTGATACGTCA
CCACACTCAAGTTGGTCTTGGCTCGGATTTCGTGTTCCCACTGCGACAAGATGGAGAGTGGAGTCACAATAAGGGTAGGAGGAGTAAGCCGAGGCGCCGC
GCCTGCTTCACTTCTTGCTTGGGCATCGGCAGCGCGAGCTTGACGAAGAGATTCACATATAAGTGCGAGGCAGCATACCGTTTTGCCAAGTCCCATTTCA
TCTGCCAAGACTCCACCACACACCTTCGCGACCAGAGCGTCAACTGCTGTTGCTTCACCACGGCGCTGTTGATCGATCGTAATAGGATCACTAGGATCTT
CCTCTCGTCCCAGCATCCATTGCAACGCTTCTTTCTGGTATGGTTGCAACTCAACCAGGAGCTCCGGCACAACGAAAGGGAACACGCCTGGTTTGGCGGC
TAGAGACTTTCGACGCCTATGGCGACGGCGTCGATCGCTTGCAAAGCGATATTCCATTTCCAGTGGAAGTTTTGTGTGCAACAATGCGCCTCGGTTGGCG
CGCTTCCTTGATAATGCTGACCTGGACGAAGCTGTGGGAGGCGTTTGAGCTGCACGCCTTGCTGATGAAGCGGGAGGTGAAGCATGCGAAGCTTTTCTGG
CTGATAAAGCGGTAGAAGATGCAAATGTAGTACGTCTTGCTGAGGAAACCGTTGGTGAAGCGTATGTTCGTTTTCTCGCGGATGAAGCTGTGGGGGTCGG
GTACGACGTTCTTTTTGTTGACGAAGCTGTGGGGGATGCATGCGTTGACCGTCTTGACGAGTTTCCTGCAAGGTTCGTGTTTGGACAAGCCGGAGTGTTC
GTTCTACTCGGTGTTTCAAAGGGTTCTTGCTGCCTTCGAGTGCCTTGCGGAGTCGGCTCCCTAACGACCTGAAAGGCATCGGATGTATGAGGCAAACTTT
CCACGGCGAGTTGCTCTGGTTCAAGCATCTCTGTGTCCGGGTGATCATTTTCTTGTTGCTGTTCCACATCAACGTATTCATTTCCGTCTCCAAATTCGAA
GTCAGGCTCCGAAGACCATGGTGGCCTCTCAGTATTGTCCTTTGGCTGTGCTGAAGGTAATGATGAATGAATAGACTTTTCACCGGTGCCACTCATCTCG
ATAATTGGCTTTTCTTCCTCAGCCATTTCAGCTTCAGGCTCAGCTGTCTCCTTTTGCTCGTTCTCGTCCTCTTCCTCGCTATCACTGCTGAAGATTAGCT
CCTTGGACACATTCATACCTTCAGCAGCATCGTGA