Description :
From Genome Similarity Track
Location :
contig_24:635138- 652873
Transcript NameFunction/comments
g5494.t1hypothetical protein
g5495.t1XP_009529778.1 hypothetical protein PHYSODRAFT_263158 [Phytophthora sojae
g5496.t1RAW36702.1 hypothetical protein PC110_g7024 [Phytophthora cactorum
g5497.t1XP_008904654.1 hypothetical protein PPTG_10904 [Phytophthora parasitica INRA-310
g5498.t1hypothetical protein

Sequence
17735 bases(100 bases per row)
ACGGCATTCTCGTTGAAAGGATAGATTGTCCTCTACGCCGAGTTGTTGGTCGTGTTCATCATCCCACAGAGGCACTTGCTCCGAGCAGGCAACATTTCTT
CCGGCATCATGAAGGTGGACACTTCAAGGGTCCAACTAAAAAATCCAGCTAACGTTATAGTTTACGGTCATTTATAATCCAATCGGATTACGGCCCGAAA
AAGGTAGGTGCCTTTATCTAGACATTTCCATGCTATTTTCCTAAAACCAATCTTTCCGGGCCGTGGGATCACTGCGAAAAAAATTCAGTCGCCGACACGT
GCGGATTAGGAGACCCACGCAGCTCTCAATGGACGGCGACGGCGCGGCAACGCCCGCCGATACAGCGCCTCCCGCAGCGTCTGCACAAAACCAAGTTGTC
CCCAGCAATGGCATATCCTCCACGCCTCCCAATGGCGTCTCAAGCACGAACGGATCGTCCGCCAACGCTTCAGAGGCTGCGGACACGTTCCCAGCCCCGC
TCAAACCCAACCCGAAGCCTCAGCTGCGAGCGCCGCCCAGGCGACTGCGAAGCGGCAGCGGGAGCGGCAGCAATACAAGCTCCAGCGGCGTGCGACGCGA
GTCCGGGACCCGTCGACCCGCCAGCGCCAACATGGGCATCGTCGTGGGTACACTGAGACGCAGGAACCGGGTGACGCTACGCACAAGTTCCTTGTCCGAC
GAAGAGGCCGACGATGTGGTCACTGCGCCGCCCAGAAGCGGTGCGAGCTTGGCACCAAGACGCGCCAAGAAGCAGACGAGTCTGCGCAACATGGCGTCGC
TCGTGCGCTCGCATCTGCGCAGCTCCAAGAGTATCTCGTCTACTAGCAATGGCAGTAGCAGTGCAAGTGGAGAGGCAGACTTGGACGCAGACAGTGGAGG
ACCAGGACTAGAACGCAGCAACTCGTCGTTTGCGGGCGTCGCGCAACAACTCGTGACGTCCCGACGTGCAGCCAGAGGGTTTCTGTCCATGTGGACAAAA
GACTCCACGGAGACCATGCACGTGTATCGCGGTATTCACATGGAGAAGAAGAAGCTGGACCTCGTGAGCGTGGCCTCCGAGTACAAAGAGATCAAGCGTC
GACAGTTCTACCAAGAGCTCGTGGTCTACTTTGTCTTCTTGATGGTGCTCTTCTCGCTGCTGTCGTGGCTGCCCGTGCAGGATAGTTTCCACCAGAATGA
TGTCGTGGGCGCCCTAACTTGCCGGGAAGAAGGTGAGTGCGAAATCAAGACCTTCGCTGACATTTACGAGTTCGCTGGGAAGTTGAGAGAAGCCGTGTGT
GACCGAGATGGCGTCACGGCGCAATGGGTTCGTGTTGGTGGAGTGGGTTTCAGGCAGGTGCGCGTTAAAGAGCAACGCTGCCGCGTCTACGAAGGGTGGG
ACGCGCCGTGCTACCCGTTTTACAGCCCCGAAGTGGAGCAAACGAACCCTTTGCTAGGCGAAAATGGCACTGACCGCTCGTACGTGTGGAGGGATGGTCT
CGGCGAATTGTCACCGGAGCTTTACCGATCAGTTGTGGACTGGTTGATCTACGCTCCCGTAACGTCCTATGGCTCGGGTGGCTACGCTGTGGATCTGTGC
GATCTAAATGATGTGAATGAGCTGCAGAGCGACAACTTCCTCTCTGAGCACACGCGTGCTGCAGCTTTCAAGTTCATTTTGCTGAATCCGGTCACCCGCG
TCTTTACTATTGGAATGCACGTATTTACAGTGGATCCGTCTGGGCACCTAGACCACTTCGCACACAGCTCACACGTGCGAGTGATTGGGCACGAAAAGTC
TGAGCAGTTTGCACTTGATGATGTCGAGAACAAAGCAACTATTCAGCCCAAGCTTCACAAAAGGATCTTCAGTGCTGTTGGCAGCACGCTTTCTTTGCTG
CGTGATGCGTTTGATGTGCGCGTCTTGCTCTGGGTAGCGCTGTTGCTGTTCTTCATTACGTACTGCATCGGTGAGGCTACTGAAATGAGTACGATGGGTG
CGGCCACATACCTTGGGTCAGATATGTGGAATTTGTTCGAGCTTACACACTTGGTGGTGTTGGCAGGGATGCTGAGCTATATGGTGCACTACTATATAGC
TTCAAGCAACTTTGCACTCCACCTCGAGGAGCTGCGTGAAGGGCGTGGTGTGGAAGAACTGAGCCACTCGAATTCTCAGGAATTGTTGACAGTGTTCCAG
CAGCTTTCCGACCTTGCATCACTCGGATCTGCTATTAGTTTGCTCAAGGTGTTCAAGTTCTTGCGCATGAATTCGACGCTAAACCTCCTTTGGCGAGTTT
TGGGCATGGCTATGCGCGATCTAATGGGGTTTCTCGTCATTTCAACCTCATTTTCCTGGGTTACTCGGCTATGGGCAGCTATGCCTTTGGTTTTGCTCTC
GAAGAATACTCAACTATCAGCAAGTCATACGGCACTTGTTTTCAAATGCTTGCCGGCGAGATGGACTATGCTCGATTGCGCCAGGCTAACCCCCGTGTTG
CACCCCTCTTCATCGGCACCTTTGTTGTCTTGGTCTTCCAAATCCTAGTCAACATGTTTGTTGCAATTCTGTCGGAATACTACGAAGTTGCAAAGAACGA
CGAGTCTGGAAGTGGTGATGACGTCGAGTACGATGTTCTTGCGCGAATCCGCAGCTTTGTGAGTGCATGCTCACCGACAGTCGTCGTGCCGAAGGACCAT
GGAGTTATCCGTCTCATCCCGTGGCAACAGGTTCGTTTGATCTCAACAAACCTTGTCGACCAGGAGGAGACCCGTCAGCGTGTCAGAAAGCTTTTTCGCG
GGGCTGTGTGGCGTGTCGTCGCTCTGCTGCGCTTCGGAATGAAGTTTGATCGCCGTATTAACTTTGGTGACCGCAAGACTAACAACGGCAGTGGCTCTCA
CGGCGGCGTTGGTGGGGGCTCCAGCAATGGCAAGGATGAGCGCGAACTCGTATCGCATATCCGCCTTTCGGAGAACTTTGATCACAAGACTATTAAGGAA
ATGATTCCGATCGGCATCACTATTCGACTGCAAGGGGATTCAATTCTTGGCGATGGACTGGCGCTCAAGGTTGTGCACCACAGCAAACTGTCGGTGGAGT
GTGTTGTTCTTGGTCCTAACGACCCTGAAGGGACTGCTAGGGTAAATTCTGCTGAGAAAGTTGACGGCTCACCGAATGCATTCGCACCTCCCCGCTCAAT
ATCGTCGCTAGGGTCATTCGAGGACGAGTCCGATCTCGATGATGGTGCTCCGCGTGAGCGTATTCTTGAGCTGATGGGTGGCGAAAAATTGCGGATCCCC
AGGCAGCGACTGGCAGTCCATTTGTGTCGCACCATGCTGCAGGAGCTCAAGATGGGGCTATTGCGTGCAACGAAGCTGTGGAACTATTCGAAGGATCACA
TGGTGGATGACTATCACCTCGGTCTGCTATTTGATAGTGTTCGTGCTGATGGTCGTACCAGTCTTCGTTTTGACGAGATCTCACGTATGCTAGACCTGTT
CCTGCGCAAGGATAAGCGTAAGGCACTCTGTTCGCAAGCAGAAGTGCGGCGTGAGGCTCTTCAAGTGATGTACCGATTCCGCAAGTGCCTTATCGATATG
CCATCACGTGAGAAGGAGGGTCACAACTACCGCCCGAAGCCTGTTGACACGTCCAAGGTGGAGCTAGGTCACCTCGAGCATCTTGGTGATGTACTGGCTC
GCAACTGCCACGATATGTGGGCGCTCGAGCGCATCAAACAAGGGTGGCAGTACGGCACGGAGCGCGATGACAAGAAGAAGAAGCACCCGAACCTTGTGCC
CTATAAACTACTTTCCGTGGAGGAGCAGGCCTTCGACTACCGCTCATCTATCGAAACGATCAAGACGATTGTGTTTATGAACTACGCCATTACGCGTGCG
AACCACCAGCGCTCACACAGCGGCTCCTTCCATGACTCTGTTTCCCGGTCAGCGTCGATGATGTCAGACATTGCTGAAGGCATGGGCGGAAGCAACAGCT
CACTGATCAGTGGCGGCTCGGAGTCTACAAGCCCACGTGCTAGCGATGCCGCTGTTTTCGAGGAGCTGGGCACTGCCTCTCACCCCGGTACGCCTGCTAA
GCCTGTGCCGTCACTGTTGCGCGAAGCGATGAGCTTCCGCCGCAACAGTCTCATGGGCGATTCGCCGTACTTCACGACGTATGGAGATGGAAATGTCGAG
GTCTATCGGCCTCTTCCTATCGACACGACGACTGTGGAGCTGCCTCCTAGGCTCTTGCGCCTTGTGGACCTGCTGGCCGAAAACGCACACGAGGTCTGGG
CTAAGGGGCGTATGGATGAAGGTTGGACCTACGGCCCTCAGCGTGATGATGGTTCGAAGAAACACCCGTGCCTTGTGCCCTATGTGTTCCTCACGGACGA
TGAGAAGGAGTACGACATCAACATCGCCAAGGAGACGCTCAAGACTCTGATCGCGATGAAGTTCACAATTCTCGACCGCTCCAGCAAGTACTAATCCTGC
AGCGATTTCTACGTTGGTATCGACGCAGGTAGCATACACGTATGCAAGCTTGGGGCCGCCACTACTGTGCGCTTTGGTGCATGGCTCGCTAGCAATATTG
AACACTTGGTTTTACGCCAGATGCACTGCACTTCTTGAGGTTCTTGCGGAGGGTATGGTTGGTTTTCGCGTTTTACTTCGATAGAAACAGAAGATTGGCT
TGGCGAGGTCCACGGATTCCGTAAGAGCAGAAGGTGAGCCTCATTGCTGCGTAGCGTTATTTCTGAGTAGTATCATAGCATTTGTTCGATGCCATCTAAC
TCATATTGTCAGTCGACAGGCATCTGAGGGGCAGAACATGAGCTCAAGTGATCATCCTAATATGCTGGATGCATTTGCGTGGTTTGTTTAATATGCCGCC
GATGGCTAGTGTCTGGAGCGGGGAATTGATGGATACATTGCATATGCAATGGAGTTACTCCTCATCAGGGGCGTCCATGAGAATGTCGGTGGCTGCCTCA
ATGGTGAGGCAAAGGCGAACAAGCTCGCGACGCACGGTCATTGCATTGCCGCGCTTGAGTTCATGCGTGACGCCAGGGAAGAGACTCACGCGATAGTCAT
CCCACTCGGAAATGCCGTACAGCACCTGGAGACAAAATAAAAGAGGGTGCAGAGGATTAGTGGGGGGGGATTCATGAGGGTTCCAGCTTGGAAAACAAGA
AACTTACATTCTTGATCCAAGGCATGTACGTCAGCCCCGAAGGGAGCAAGAACGCACGCTGAGCACGAAGCAGACGGTTGTTCACCTCCCGTACGCGACT
GAAGTCAAGCTCTTCGTTCGAGATGACATTCATTTCGTGACTGACGCTGAGAGCAGCAGCTTCGAAAGCGGTGGTGGCATTGTGCAGACGAACGAGTGAT
ACCGAATCGGCTAGACCTTCACGTCCAAGCGCATCCTCCAAGAATGCCTCGCCACGCCGCAGCTCACGGGATAATTCGGTGAAATCGTACTGCAGAAACT
GCGCGTCAGTGAAGGACAGGAGGATGCTGCCGTAGAGCTCAGCAGCGGCGCGGTGGAATGCAAATTGGGGGTCAGCGAAGTGTGAGATCCAAGCAGGGGT
GTCCGCGCCCGTGTCTCCTACTCCAAAGTAGCCTCCGTCAAAGCCAAGCTCGAGCGACGGTATGCCCAGCCGCCCAAGGAATGGGGAGACACGTCCTCCG
AGGGAGCGATCCATAGGTGGCAGCTCCAGCTGGACATCGCTCGGGTTCTTCTTGTTGGCATCGTCAAGCCAGTATGCGAACACGGAGTTCCCACTGCCTT
CAGGGAGCTCGTTGCTTGAGAAGGTAGCATTGATTGGCAACATGTCAAGATCGTCTTCATCTCGGCTGGAGCTCCCGGCGGCAAAAGCTGAGGCGCTGGA
TAGGTTGTGGAAGAAAAAGCTCGCAACGTCAGGGAAGGTCTGCTTCTTCGGTTGAGCTACAGCAGTCATGAGGTAGATGTTCTTGCGGATCGTAGCAGAG
GCCTTGCAGCGAAGTGCGCCAGCGCCGCGCACAACATCATCCAAGTGCAGGTAGACGACACCACGCCCAGCGTTCCCACTCCCGAATCCTGGGTACCGGT
CGATCCAGTGCGAGCTACCAACCGAACCAAACTGTTCGCCGCCAAACGAGGCGAGGACCAGCGTGCGGTAGGGGGTCCATCCATTTGTCAGGAGAGTGCC
AAGAGCTCGTGCAACCTCCAGGAACACCGCGTTTCCCGATCCTGGGCTAACCGCGCCGGCATTGAGCGAGTCACGCGGAGCACCCACGAGCACATGGCGA
TCGGGTTCGCGAGAGCCGTGCACCGTGATCACGACGTTCCATGTCGTTGTCAGCGAGTACACATTGCGGTTTGTCATTTGAACGACAATGTCCGCTGCTC
CCGATGAGGACGTGGCGCCATCTACTGGGAGTGTGTACTGTACGCTCAGCGCACCACCCTCCCAACGCGCCCCGAACACGTCCGCAGCTTTCACAGACTC
GAGGTCAGCCACTTTGTCAGCAGCACTTTCCATTTGAGCGAGCAACTCCTGAGCCACCGCGGCGCTGATGGGCATGCTGACAATGGGCGGGAGGATGTTG
AACGTGTTGTTCGTCGAATAAACATCGTCGACGGAGATGCGATCGGCGTTGGTGCCCATGGGCCGCGTAGCCGAGAAGCCTTCTGGCATGGTCGGATCGC
CGTCTCCCATGTAGACGTTGCCGAACGTTGTCGTGGTGCTGGGACGCCATGGCCCATCGGGTGCTGTGGGTCCTCGAGCAGCTCCATCGTCAGCTGGGTC
ACTACACAAAGGCACAGTGTTAGTGCACACAGTTGCTGGACGAATACACTCGAGACGCTGGGCACTTACGTGTATGTGAGCACACCGACTGCACCGAACT
TGGATGCCAAGACAACCTTAGCTGGAAGAGATACGTCACCGCCCATGCGAACCAGCACGATTTTGCCAGCCACAGACACGTTGTTCAGTGCCAGAGCATG
GTAGTCCTCTGACGCGCCAAAGTGAGCATATACAATTGCTCCTGATGCAGTGCCGTTCTTGGAGTACAAGTGGAACGCAGCGTGCGGCTTCGTCATGTTC
TTGCCCTTTGCCTGTCGCTTCGCCTGTCGAGCTGCGTGTTCAGCTACGAAGTCGTACGTGGCCAGCGTTTTGTTGTCGGACTGCTGAAGAATATCTAGGG
TGAGCGTCTCAGGTGCGTTGATGAGCATTTCGAACTCGTCCAGCTTGATGGAGCTCTCTGCAAAGCCGAAATCAATGGCTTGTGCGCGGATGAACTGTGC
CATCTCATAGTCTCCGGTGGTGCCTGTGTGTCGAGATACCTATTGTGTGCACAACCACCCAGTTAATGATCAAAATGCAGATGCTCGCTGCCGTCAGACG
TACGTTGGTGTAGAACTCGAGGTTCTTCTTGAATCCATCGGCCGATGTGGCAGCGATGAAGTGGTGTTGGATGGCTGGCGTCGAGCTGTACACAAGACAA
TACAGGCATCACCAGTTAGTGTTCGCCTGCATCGGCATGTATCTTCGTTACGCAAGGCTTACCCGTAGTTCTCTTCGTGTCCGAGAATCCCCAAGAGCAT
GACGCAAATGGAGCTGGCAAGAAAGAGTGCCGTCACGAAGGCGATTCCGACGCGGCGACGAAGCACAATCTCCTCTTCGCTGATGCCTTCGCTCACTTGG
ACCTCGCGCGGACTGTCGGCGTACACGTTCGACCTCGTCAACGGCACCTTGGACTCGTCGCCACTGCTATCGCCCTCATCGAGGTCGAGATCGGGGAGCA
CCTTGAGTGCATCGCCCTTGATGATGCTGGCTCTGTCTTCGGAAGAGCCCATTGCGACCTCAACTGCAGCTAGACGTTGTTCTGAGCTCCGCTAGCTGGT
TTCAGCAATGGGTGCTCCGCCAAGACCAAGACTGCACTCGATCGCACAGCCGTCTATCCTCGGAACTGCACTACGCACGCTATTTTTTGCTAGCAAGGTG
AGATCCTGCGCCATGCTGACAATGAGGCAGCAAGAATAGCATCCGGCCAGCTCCTACTATTCCTGCTTGAGCGGGCATCATGCTGAGACTCGCCCGCTAC
CATCTGACCGACTTCAACTTTGGTCGCCACAACCGGCTTTCTGCTTGGATCAAGTCGGTTCCGAAGGGCTCACTTGGAAGTGCGCTAGACACGCTGGAGG
GAGTCCACGCAACAGGACGATCATACTTTTTCTTGGGTTTACATGTGCCACGCCTCCGGTTGGCGTGGCACCGTCCTCTGCTTCGTCGAGGGACACTCGC
TCGTGTCTGATCCCCGTCCTAAAATCTACACTAGTTCACAAGTAGGAAGGCGAGGCCTGCCTTCAAGTCTCGCGAGCTGTCCAGCAGCGTCGCGGTTCCT
TCCTCTCCTCTTGTTTATTTTTCTTGTCATGTTTCTTCCATCAAAACACTCACTCACTCACCGCGCGCGAGCTCCACTCCGCTCCGCTTTCAACTAAAAC
AGCTGATGCTTCGCACTTTCTTCTTCGTTTGGCCCTCGAACATGCTCTCAGCCTGGCGAGTAGCCTCAGCCACGATAGCATCAAAGAAGGCCACACCGTC
CTTATCCCCCGACATGCCCTCCTCCACAACCGCCACCGCCTTGGCAACAACCAATTCCAGCTGCGAGGGCGACGTGAAGTCGCCTTCGCGCTGCAGCAGA
CTGCCGATCTCGAACAGCGAGAACCCGGCCTCCGCTCCACGCTTCAGCACCGCCGTACACACACGCATCGTCGTCACGCACTCCTCCTCAATCCCAACAG
CACGCAGCACGGCCGCATCGCGCGCTTCGTCCAGCGACGCGATGTGGTCGAGCTCAGCACACGTAAACGGGAACTCGGCCTGCGGCCACTGCAGCCAGTC
AAACGTCGCACCGTCCAGGTGCTTGTAGGATGGCAGGCAAAAGCCGTGGTCAATCGGCGTCATACCGAAAGTCTGGTCGTTGGGCCGGGCGCTCAGCAAA
ATGTTGCCGGCGTGGCGGTCCGTGTTAAACAGCCGCACGTCCAGAATGCCGATCTTGTGCACCTCAGGGATCGCGAACTTGAGCGTGCCCATGTCTTCAG
CTGAACATTGCGAGGCCACGAAGCGCTGCATCGACCCTTCCTTCTCCTCTCCATGTACACTCAAAACCATCAAATCCGTAACCGGCACGCCACTAAAGTT
GCCGTATGCGTTGTCGAGCAAATAAGCGGCGCGTTCACGGAGCGCGCCGTTTCCAACACGGAATCCCCTGTTCACTGGGTGCTCCGTGACGCCCACCACC
GCGTTCTCCTTCACGTATCCTCGCGGGTTCTTGGGGGCCATGTACTCTTCGTCTCGCGGCTTAAAGATCCCCATCGGGTTCATCTTCCTGGCAGAAGACG
TGGTCGATACCGTCGTCAGGTAGTACACACCGCCGCATCCGTCGCTGGTGATCTGGAAGCTGCTGCCTACGTCCGCGACCATGCACTTCACCTGATCAGC
AAAGCGTTCCGAGGCTTCGGTGGTGAGCCACTTGGCCCCCAGAGCAGCAGGCAACTTCGTCTCCGACTCGCTCTTGTCCACAATAGGTGCCTCGCTGTCG
CGCTTGAAGGGTGACGTGCAGCGCAGCGGCGACAGGCGGGACTGCACGATCGGGTACAGTCTCGTGACCACGGTCTGCTGTAACAGGCCCTTGGCGTTCA
GCATGGCCGAGCCGTGCACCCGCAGGCGGCTGAAGCGACTCGTGACCCGCTTGTTGTTGCTTGCCACCGTCGCTGTTTCATCCGCCTTGTCCGAGCTCGC
GCGAAACCAGTCAGTGGCGCCCATGCTTCCTCTCTGCTTTTCGGTCTCTTCTGGGCGGAAAAAGTCTCGGGGGCGGGGCTTTTTATCCGATCTGCTCGTA
GGCGAGGAGGTCAGAAGAGAGGAAGGCAGAGAGGAGAGAAGGAGCGTCTCTCTGGATGGAGGCTTGGAGAAGGCGGAGGGCGGAGCTTCAAGCGCTGCGC
AGGGCGGAACGACGTGCGGACTTCAGTTCAATTTGCGGAATGGCGACACCACGCTGGAAAATAGCCAGCCGCATTCTCTATATCATGGTTTGCAGGGACT
GCATAAGTAAATACATTCTAGATAAGAGGTATGCATTATAAAGAGATTTATTTGTATAGAAACACTTGCAATAGTGAATGGATTTGTGCTATAGATAATG
CAATTGGGAGGGAGCGAGGGACGGGCGGTGCAAACGCGTGCATTCAGCTTGCAGTTGTGGCAAGCAAGACAAGATCAAGCGTTGCTAACAGTTGCCGAGA
TTTCGCGAGCGGCGCACTGCGACAGAGTGCGATTATGCCTATAAGAGACATACTGTGTGACGAAACGACTCGCCGTCCATCATGAACTTCATGGGCACGA
GCGTCTTCCGCAGTGCGGAGACTTTAGTACGCGCTAGCAAGGCCCCACATTGCTGCACGCTTGCCTTAAGCAGGACTTGACAAATTATCAATATTAATAG
TGTAGCTGCGAATAGTACATGTAGTATTGTGCTTTGCAGCTCTTTGGACTCCAATTCGTACGCTTTGTCTTGCACGATACAACAATAAAGCGTACATGCT
TCATACTCTCCCAATATGTGCCTTGGTGATCTGAAAACCCTGCCACGACTTGTGGTTGCTTTGGCACTTTCTAGAAGTGTGCCTGAAACACAAAGTCTCT
ATGCTTTAGCGCTAAGTACGAGTACTAACTACTGCTGGACAAACTGGTTGCAAAGCACAAAAAATATACTTCGAAGTAATACGTGTTCTGTGCTCATAGA
AACTTTCTCAGCTCGGTGCTGTATCCAGTAGGCACAGATCTGCGTGGACTTTGCCAGCTATTAATTGTGATTGCTCCAGACTGTAGCCTTGCTGCTCTGC
TACTTTCGTATCAGACGCGCACTGGATATGGTCTTGCCACCTAGGGCCGGCAGTACTGGCACCTTTCCCAACAGCTACTATAGTAATAGTACTGTCGAAC
AACGTTCTGTCAACTACCGAAATGGCTACCTTCTTACACGATCTCCATAACTGTCGATAAAAGTTCTCCCCGAGCGCGTTCGAAGAGCTCCGACCTAGGC
AAATACGAGTTAGTGGAACGGCTCCAAACCCGACACACGAAACCACTGGCAAAGGGACCAGGACGCATTGCCAGCCCGTCAAACCATCAGCAGTCCTCCA
CTCCTCCTTCGACTAGCCGTCGGCAACATGACGCACAACAATGCACGGTATCGTGTATCACTCCCTCTGGAATATGTCTGCTTCGTCGTGAGGACGCCTC
GAAGGCTGGACACGGTGGATAGAATCATCGCCAGTACACACACAGTTGCGTGAAGACCTCAGCGCCATGGTCGCAGCGCTGGTATTCCAAGATCGTGAAT
GACACTCCACACGTTGTTACCATTGAGGCATTTGAGTGGGAAGCAGTGATCTGCAAGCTGCAACTTGCAGTTCACGTGCGAGTAAGACGACGAGAATCGC
ACAAACGCGAAAATGGGGTGGCATGTAAGCAGCAATTGCGCGGTCTTGTTATCCATGGCGGTGGGGATCGGTGCTAGTTCAACAGTGCTATCGACGTGAC
AGGCTTTACAGTAACAGTAGAATGGAAATCGAGCAAAAGAATAGTACTACAGACAATCCTCTCGGTCGTGATATCCTGAGTAGTGATACCCTCCACGGAG
AGATATGGGGAGGGCTCCCGATGACCGTCACCATACAAGCACGAGTCAAATATACCTCTACCCTCTAGTTACTGGTTTGTGATACAAAACACGTCATTAT
CACTATTCAAAGGTGCTTAACTATTGCTAAGGTCCATTTGGTGCAGGACGTCCGAAGAAGTCGAGCATCGACTTTTGCTGCTTGTGGCCTTGTCTACACG
CAAGCTCCTCTCTAAATACTCGCTGCATCGTTCGAAGCCCGATAACGTCCCTTGAACGGACCCCATCGCACCGGCGGTAACGAAAAGTTGTGCTATCCAT
TGAAGACGCTCCTTCAGCTCCTCTGTGGACAGGTTTCGGGCGTTGGATAGGTTGAAGAAGTGCTTTCTTCTTCTTCGTCCTCGATACCGCCATCACCGAC
ATCTTGACCGCACCCATTCTCGCGCTCTGAAGACTCGACCCGGCAGAAATCTTCGTCCGTTGGTTCATCCGCGAGGATGTTCTCGTCCGGTGGGTTCAGC
AGCTCTTCAACCGACATCGGATTCGAGGGGTGGAGACGCGTCAGCATCTCTGCCAGCTCGTTCACGATGTCATCCTCCACGCCCGGCTCGGCGTACTCGC
ACGTGTAGTAGTCAAGCAAGCCAGTCTTCTTCCAGCAGTTACTGAAGACGCTGGGAAGCAGGGCGTTCCAGCTCTCGATGCTCCACAGTACTGCCTGCTG
TACGTCGACGCTGTAGAGCTGTTAAGTTCAAATGTACCAATTTTACGGCACATTTCTGCCTTGTAATAACTCCAGCGAGTGATAATGTGGTGGTTCCCGA
CGCTATCACAAAGGAGAGGATTGTCTGTACATAACAGTAGTACTATTTTGTGCTGGTGAGGCGAGTTACTGCCGATCCCTACTTGTCACATTGTAATCTT
GCGGGCTCCCAACGTGAGACCTTACACCGTAAGGCTTGCTGCATTCGGCGAAAGCTGCCACCGACTAATCTGGCGTCTGTAGTCGTTACGCGGTATTATA
CATGTAGTGCCAGCAAACGCATCACTGTTGATGCTGGGGGGGGGTCTCTTCCGAAATGGCAATATGCTGCATAGCCTGCTGCGACGCCGCGCGCTGGGAT
ACCAGTGCTGTACCGGTTGGGGCTGCTGCCTTTGATTGACGATTCGGACCTGCAGCCGAGCAAATCGGCGCTGAAAATTGTAACGGGAAACCCCCGCTGC
ATGGTGCGCGTCCTCGGCAGTGTGAGTCGACACTACTATAATACACCAACATGCTGCCCCTGTGCCACCGGAGGTGGCGCTGCACATTGCCATCGGCAGC
TGGCCCTTTGCAGGCGTCAAGGCGCGCGATCCTGTCGCGCGGAGGCGCCTGTTGGGGGCTCATTTGCAGCTGTTGTTCGCATCCTTGTCCTCGTCATATC
CAGACTTGGCGCCAGAGAGAAGCCGCGGCGTGGCACGAAGTCAACCCGGGCCCTCTTCAGCTATCAGCTGCTGCTGGCAGCGCGCCATGCCGCGCAGTGC
TCGACGTGTGCAACGCCCGAGGCGCATGGCTTTCTAGACCGCTGCCACCTCATGGGCGAACCGACAAGCTCAGTTGCTATTGTTGCTAGACTATGCCGTC
GAGCGCTGTCAATGCCTCAATGCCTCATCCCCTGCCAGGTGTCAGCGATTAGCAACTACCGTCCGACACCGGTCTAAGTGCGAATGGGTTCGCTTCGACC
CGGTGTGCATAGTATGGTCATCATATGGTACCAACCGCTTCGATTGGTCGAAATGCATGGTCATACAGCGTTTCTACTCGCTGAAATGTTTGCTAGGAGT
TTTCACCAATCAGACGTGCCCCACTACCCGCCCGCCTGGGATCACAAAGCCCGCGGCCCATATTGCGCCGATACCGGTTCGTCCATCATGAGCATTGGCC
TCCCTGCCTCGCGCTCTTAGCGCCATTCCGCGCTTTCCCGTGGCCTGCACAAGCGTCTTGTTGTATATTCCTATCTGTCCATAATGTCCATCCTCGATGT
GTGTGCGTCCCCCATGCCCTTCGCGCTCCCCATGGAGTGCGCCTCCGAGTCGCTCGAGGTCATCCAATGGGCGCTGCTCAAGGAGAAGCACTACTCGGCG
CTGCGCAACCCGCGCTACCTCGCGGACGTGCAGCGTCACGGCATGACGGCCACCTGGCGCCTGCGCGTGTGTCGCTGGATGTTCGAGACCGCCAAGGAAT
TCGAGCTGCAGCTGGACACGGTCTGCGGCGCGCTGCACTTCCTGGACCAGTACCTGAGCGTGCACTCGGTGGACCGCGTGACGCTGCAGCTGCTGGGCAT
GATCTGCATGTGGACGGCCAGCAAGATGCACGAGGGTAAGCCCATCCTGCTCGAGGAGATGGCGCTCATGTGCGAGCGCAAGTTCTCGCGCGCGCAAATG
ATCGACGCCGAGGCGCAGCTCGTGCGGCTCGTGGGCTTCCGCTTCAACCCCCCGAACGTCCTGACCATGGCGAGGGACTTCGTGAACGAGCTCCCGTTCG
ACGACGACCAGCGCGCCAACTGCGTCGCGTCCGTCTTCAACGTGCTCGAGCGCGTGCTCGAAGACGTCTCGTCCCTCGACTGTTCCGCCTCCAGTCTGGC
CAAGGCCGCGGTGCAGCTCGTGGCCAAGTCCGAGTACAACCTCACAGTGGCACAGGTGCTCAAGGCTCTCAAGTCCATCAGTGTCGAGGAGGGCGCCTAC
CGCGCAGCCTTCAAAATTGTGCGCGGCGCCTACTTCGGTACGTCCCCCGCCTCGACCAAGACCCAGATATCACAATCTGTCGCTGTGGAGGCCATCAAGT
CGCTCACGCAGAGCCCCACGGCCATCGAACAAGTCGCTGTTTTCGCCGACGACACACCGTCGCCCCCCGACGTGGATGACTCGTGCCTCATCTGTACCGA
GACGCTGTCTCCGTCCCCATCCCAGGCATCTCCTGCGCCCGTGCGAACGGCTGCATCGGCCTCATCAACCATCGGAGTCACTCGGTCTGCGCCCTCACCA
ACGTGCATCGAGTCCGATACCGAGCGACACAACAAACGTCAGCGCAAGCTGGACATGTAGACACAATAGGAATCAACAAGACTGTAGAAAGGAAGGCGCT
AACGGAGCCAAAAAACAAACTAATTTATACTCTACGCCTACTTCCTATTCACTGATCTCGATGCAGGTCACACTACCGTCGCTGACTTCAGCATTTTCAC
CACGACGAGCGCTGCTGGCGTTATTTTGGTCGTCCTGCTCTTCTTGCTGCGTGAAGAACAGCCTCCTGAGGTCTCCTGTAGACAGCCGCGTCTCACGTAA
CCGGTTCTTCTTGGCGGTGGAGAGGTCATCGCCATCGCCCAAGAATGCGGCCGTAAGCTGGCGCTTCTTGTTCTGCAAAGCCACCACGCGCTCTTCAATG
GAGCCTTTCACGATGAAGCGAACGACACGCACGTTCCTTGTTTGGCCAAATCGATGAGCACGATCGACAGCCTGCCGCTCAAGGCTGGGGTTCCAGCTAG
GCTCCGTGATAAACACGTGCGCCGCAGCAGTCAAATTCAATCCGAGACCACCCGTGCGCAAGGACAATAGTAACACGTCCAGTGGTGGGCCAACGACCGG
TCCAATGCCGAGGTTGTCTTCGTGCTGCTGGAAATTACGCACGACTTGCTCCCGATCCTTGACTGACATCCTTCCATCCAGTTTAGCGAACGAGATGACC
TCATTGCCCACCTCCGATGCATCTTCAAAGGATGAAACGCACTTCTCGCACCGAGAGTTGTGAGCCTCAAGGGCCTCCGCTATCACATCCAAGAAGCTTG
TCCACTGTGAAATCACCAGTACACGCTCACGACGTGCTCGCACCTTCTTCAGCTCCTGCATTAATGCTGTTAGCTTCGTCGATTCCAATGGACCGCACCC
AGACACAGCATTTCCATCAGCGCGGCGTTCTTGAAGCCGCTTCAACAATGCTGCTTCTCCAGAGGAGAACGGAGAAATGCCGTCCCATCCGTTCCCTACC
AGTGCTTCAGCACTTGCTGCCCGAGTCTGCACTTCAGCCAATGGGTCTTTCGTTACAAGTGAAGTTGCATCACAGACCTGCCGCAGCCGCAGGATGAGCT
CAAAGACGTGCATGAATAGCGGGCGCTCGTCCCCGTCGTTGGCTGGAGTTGTGACGGGAACACGACGAGCTTGCTTCGACTCCTTGGATTGCAGATACCG
CAGCACTTGCCTTTTAGTAGAGCGATGCAGTAGCATATACAAAGCGCGCTCCACATCTGAAGCAAAGTCAAGCTCGATAAGCTCTTCAGTCTTCTCCGGT
AAGTCCAAGATAGGAGCTCTTGAGCGTGCATCCACCGCGGATTTGAGTCGGCGCATTACTACACGCGGCACCAATGCTCCAAGCTCACGTTCAGAAAGTG
CGTGCGCACGGTTACCAAGCCCAGCAAACTGCAGTAGAGCTACAAGGTCTGCCGTTCGGTTCTGGATGGGCGTGCCAGTCACACACCAACGGCGTCTACT
GCTAAGAGTGAATGCAGCTCGCGCTCGTGCGCATCCAGCATTCGCGATAAGGTGGCTTTCGTCAAGGATGACTCGGAACCACTGCAACTGATGCAGCTTC
GAAGTTACCACCGGTCTCTTCGACTGTGGAGTAAGACGTGGCGCTTGATGCCATCCATCTCCTGAAGCAGTACCATCGCCGTTGTCTTGTTCGCCATCTC
CATCACTGTCCTTGTCTCGAATTTTGCATTCCAATAGGCGGAGAGTATCATAGGTCGAGAGCACGATATCTGCCCCCATAAACTGCGTTGCAGAGCGGAA
GCTTTTGCGCGTGGCACCTTGATACGTCACCACACTCAAGTTGGTCTTGGCTCGGATTTCGTGTTCCCACTGCGACAAGATGGAGAGTGGAGTCACAATA
AGGGTAGGAGGAGTAAGCCGAGGCACCGCGCCTGCTTCACTTCTTGCTTGGGCATCGGCAGCGCGAGCTCGACGAAGAGATTCACATATAAGTGCGAGGC
AGCATACCGTTTTGCCAAGTCCCATTTCATCTGCCAAGACTCCACCACACACCTTCGCGACCAGAGCGTCAACTGCTGTTGCTTCACCACGGCGCTGTTG
ATCGATCGTAATAGGATCACTAGGATCTTCCTCTCGTCCCAGCATCCATTGCAACGCTTCTTTCTGGTATGGTTGCAACTCAACCAGGAGCTCCGGCACA
ACGAAAGGGAACACGCCTGGTTTGGCGGCTAGAGACTTTCGCCGCCTATGGCGACGGCGTCGATCGCTTGCAAAGCGATATTCCATTTCCAGTGGAAGTT
TTGTGTGCAACAATGCGCCTCGGTTGGCGCGCTTCCTTGATAATGCTGACCTGGACGAAGCTGTGGGAGGCGTTTGAGCTGCACGCCTTGCTGATGAAGC
GGGAGGTGAAGCATGCGAAGCTTTTCTGGCTGATAAAGCGGTAGAAGATGCAAATGTAGTACGTCTTGCTGAGGAAACCGTTGGTGAAGCGTATGTTCGT
TTTCTCGCGGATGAAGCTGTGGGGGTCGGGTACGACGTTCTTTTTGTTGACGAAGCTGTGGGGGATGCATGCGTTGACCGTCTTGACGAGTTTCCTGCAA
GGTTCGTGTTTGGACAAGCCGGAGTGTTCGTTCTACTCGGTGTTTCAAAGGGTTCTTGCTGCCTTCGAATGCCTTGCGGAGTCGGCTCCCTAACGACCTG
AAAGGCATCGGATGTATGAGGCAAACTTTCCACGGCGAGTTGCTCTGGTTCAAGCATCTCTGTGTCCGGGCGATCATTTTCTTGTTGCTGTTCCACATCA
ACGTATTCATTTCCGTCTCCAAATTCGAAGTCAGGCTCCGAAGACCATGGTGGCCTCTCAGTATTGTCCTTTGGCTGTGCTGAAGGTAATGATGAATGAA
TAGACTTTTCACCGGTGCCACTCATCTCGATAATTGGCTTTTCTTCCTCAGCCATTTCAGCTTCAGGCTCAGCCGTCTCCTTTTGCTCTTTCTCGTCCTC
TTCCTCGCTATCACTGCTGAAGATTAGCTCCTTGG