Description :
From Genome Similarity Track
Location :
scaffold_132:63506- 65344
Transcript NameFunction/comments
g4294.t1 ATP-dependent RNA helicase DHX8

Sequence
1838 bases(100 bases per row)
ATGAAGGCAATTGCTGACAACCAGGTTCTCGTGGTTATTGGAGAAACTGGCTCAGGAAAAACAACTCAAATGACGCAATACATGGCAGAAATGGGATTGA
CTTCGACTGGAATTATTGGGTGTACGCAGCCACGTCGTGTCGCTGCTTCATCCGTCGCGAAACGTGTTGCCGAAGAGTTTGGTTGTGAGCTTGGACAAGA
AGTTGGTTACTCGATGCGTTTTGAGGACGTCACTAGCCCGGAGACAGTGATCAAATACATGACAGAGGGTATGTTGCTGCGTGAATATCTGGCTGACCCT
ACTCTGTCGAAGTACAGTGCTCTGATGCTTGATGAAGCCCACGAGCGGACAATCAACACAGATGTGCTGTTCGGATTGCTGAAAGACCTTGTGCGGAAGC
GCAAAGATCTAAAGATTATTGTGACCTCAGCAACGCTGGATGCCGAAAAGTTTTCACGATATTTCTTTGACTGCCCGATCTTCACAATCCCTGGGCGTAC
CTTCCCCGTTGAGATTCTATACACAAAGGAACCGGAGCTGGACTACCTGGACGCTTCACTTCTTTGTGTGATGCAGATTCACCTGTCAGAGCCTGAAGGA
GACATCTTGCTGTTCTTGACTGGTCAAGAAGAAATCGACACAGCTTGTGAAGTGTTATATCAGCGAATTAAGGCGTTGCAAGAGCGCGCACTGGCCCCGG
AGCTTATTATCCTACCAGTGTATGGTGCTCTACCTTCAGAAATGCAGTCACGCATTTTCGAACCAGCACCAAAGGGCTCACGCAAGTGTGTCGTGGCGAC
CAATATTGCTGAGGCATCGCTGACGATTGATGGCATTTATTATGTGGTGGATCCTGGCTTTTGCAAGCAGAATGCCTTCAACTCGAAGATCGGGATGGAT
TCTCTCGTGGTTGTGCCGTGCTCACAAGCCTCAGCTCGTCAACGTGCCGGGCGTGCTGGGCGAACGGGCCCAGGCAAGTGTTACCGTTTATACACAGAGA
ATGCTTACAAGAACGAGATGCTGCCGACGACTGTGCCAGAAATTCAACGCGCAAACCTGGGCTCTGTTGTGCTGCAGTTGAAGGCAATGGGTATCAATGA
CCTCATGGGTTTCGACTTTATGGACCCGCCGCCACAAGATGCTCTCGTTATGGCGCTGGAAAACTTGTATGCGCTTGGCGCATTGGATGACGAAGGTTTG
TTGACTCGATTGGGAAAGAAAATGGCCGAATTCCCAGTGGAGCCAAAGAACGCAAAGGTGCTACTGACTTCCGTGGTACTGGGTTGCGCTGAGGAAGTGT
TGACTATCGTGGCGATGATGTCAGTGGAATCCGTATTTTTTCGACCAAAGGAGAAGCAGGCCCAGGCTGACCAGAAGAAGGCCAAATTTCATCAGCCTGA
AGGTGATCACTTGACCTTGCTGGCAGTCTATGAGGCTTGGGCGAACTCCAAGTTCTCCAACCCGTGGTGCTACGAAAACTTCATCCAGGCTCGAGCTATC
CGTCGAGCACAAGATGTGCGCAAGCAATTGCTTTCCATTCTTGATCGATACAAAATGGATGTGGTTTCCTGTGGCAAGAACTATAACAAGGTCCGCCGTG
CAATTGTTGCCGGATACTTCGCTAACACAGCGAAGAAGGACCCGCAGGAGGGATACCGCACCATGGTTGAGGGTCAGCCTGTGTATATTCACCCATCGAG
CGCGGTGTTCAACAAGAGTCCGGAGTGGGTGCTCTACCATGAGCTGGTGCTCACGACGAAGGAGTACATGCGCAACATCATGACGATTGAACCCAAGTGG
CTCGTGGAACTGGCCCCTGCATTCTTCAAAAAGGGAGA