Description :
From Genome Similarity Track
Location :
contig_27:635026- 636807
Transcript NameFunction/comments
g7063.t1hypothetical protein

Sequence
1781 bases(100 bases per row)
ATACTGTTCTACTCCGCGACTGTAGTGTGGCTGGTGCTTCTGCGTCAGATTGTGGTCTTCTGTCGGTTCTTGACACATTTGAAGCTGCAGGCAGACAGCT
CGAATGATTCGGCGCACACATCTTCACTTGGCAACTACTTCAACAAGCTGTCGCTTCCAACGATAAATGAGCGAGCACGGCTTGTGAAAGCGTTCAAGAA
GCTCCTGTATCGTGCGGTCGCTCGTGGGGACGTTCTTACTGTGGAAACGCTCCTGTCCGAGTCCCAGTCAAAGTACAAGATTGACCATATTCAGGACTTG
TACAGGCCGCCAGTGCTGTGGTTTTACGCTTTCGCGAAATCGAGAAAGAATCCGCTTCATATTGCCGTCAAGCGAGGCAATATGAGGATCGTGCAGATGC
TGCTGGATAGTGGAATTGATGTGAACGTACTCGACAAAGTAGTGCGGTGAACTTCAATGTTGGTCTTGTGTTTAAGATCTTCAGTCGCATCCTGGTAAGC
TGCGAGTGCTATTTGCTGTATGTGCAATTGTACACGACTAATATTTTTTGTGCTTGCACTTGCGTAGGTTCGAACGCAAGACGGAGTTCGATCACCCCTC
AAGACGCTCCTATGCTCCGTTCTCCTTCCTCCACTTCACGGTGCAGTAGCCGAAGGCTACGTTGATATTGTCCGTTTACTTATCAGCAAAGGTGCTGACG
TGAATGCTCTCCCGCGCGCTTCGTTTTACTACCCGGCAGCCGTTCTTCCACCTATATTCGTGGCGGACGACCCGCAGGTGCTGCGCTTGCTGGTAGCAAA
TGGCGCCAACTTCCTTCAGGTTGCATCGGTATCGCTGACTGGTTTGATCCGCACGTACGCAACGCCGCTGCAGCAGAGTACGTTTACATTGAGATCGGAT
CTGAGCGATTACTTGCTGGACTGCGGTGGTGACGTTGCACTGACACCACTTCACGAGGCAGCAGCCACTGATAACGTCGGAAAAATTAAGTGGCTGCTCG
CGCGTGGCATTCACGTGGATACGCTGGGAGAACGCGTTGAAGGTGTGCACCGTCGGACGCCGTTACACTGGGCGGCAGTTGTTGGAAAGGTAAACGCCGC
CAAACTCTTGCTGGAAAAGGGTGCAAACCCCAACGCAAAGGACCGCGATGGCCGCACGCCCTTGCATTGGGCAGCCAGAAACAATCACGATGAGGTAGTC
TCCTTACTGCTCGCTCACAAGGCTGAGCCTGATGCGGTTGATGGTGAGGGCATACCAGTCGTGTGTTTTGCGGCGGAAGCTGAAGGTGTCGATTCGACCA
TTTTCTCTAACCTGGTGGCTGCTGGCGCGAGTCTGCGAACCCAAGTGTCAGGCGGAAACACTGCGCTGCACATCGCTCTGCAGCGTGAGAACCGGCAAAC
AGCAGTATCGCTGATCAAGTGTGGATCAAGTATGATGATCACGAATGATTCGGGCAAGCGCGCTGTGGACTGCACGACGTCTACTGAGCTGCAGTTCTTG
CTTAAGAAAGAAGCAGGAACCCGCAAGATCATGATCTCGTACACTCACACACATGCACAATTAGCGCAAAAAGTTCGCGAACATTTGGAAACACAAGAGC
AGCTCACGTGCTGGATGGATACCATGGATCCTAGCGGAATTGGCGGTGGCGCGGTTTGGCGAGAGGAGATTGCGCGCGGTATCAACAACTGCTCGCTAGT
CCTGAGCATTGTGTGCGACGGCTACACCAAGTCTGAGTGGTGTCTCAAGGAGCTTGCGCTAGCAAAGCTGCTCCGCAAACC