Description :
From Genome Similarity Track
Location :
Scaffold_2229:635- 1795
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_2229-snap-gene-0.1HECT ubiquitin ligase

Sequence
1160 bases(100 bases per row)
GTGGTGAATCCGTAGAGTTCCGTCTCGACTGCAGCGTACAAAACGGCCTTGAATTCGCTGCGAAGGACGTGCAGTGGCAGATCTAACCGATTAAAGCACG
CGTGGCTCCAGATGTAGCCATCATTGACTAACGGTACACCTTTCAGCGTGAATGGACACAACTTGCCGTCGTAACTCGTCAGGCCAGCAAATCCGGAGAG
AGGTACTCGGGACGAACCGGTCGCAAAGTGCAGTAATCGACGACGGTACTCGTTCGGCATCTCACGCACCAATTCCCAGAACCACTTGATGACCGGGTGG
GTGTACAAATTCTCTGTGTGCTTCGTGTTTTGCTCCCAGTCGTCGACGTCGATTTCGTCCGATCCGCAGAGCAGATAGTCGAACTCTTCCGGATCAAACA
GCATCAGTAGCTCCCATGGAATCACTTCGTACAATCCTTTCAGAAACACATGCAATTGGTCGGCCACGCTCTCAAAGAGCACATAGCGAAATCTTCGCTC
GATGTACTCGTCCTTGTTGTCGTCGGTCACATCTATCGATTGACCGCACGGAATCAGCTCGATCACTTCCACGACGTCGCCGCGCTGCTCAGTGACACTA
AAATCAAGACCGAGCTCGTCAACATTCTCGTTGTCACGCAGCCAGGATAAGTTCTTGAACAGGTCCGGGTCGAAATACTCAAGGTCGGAGAAGCTAATGG
GGACACCAAGAATCAGTTTTACCAATACGGGCGACAAGTGGAACCCAAGCACGGATCCTTCTAGCAAAGCGCGTCCAATCAATCGGCCTGCGGCATAGTA
ATATGAGAGATGCTTTTCGCCGATATCGTAAGCCGAGTTCGAATTCAGGAAGAACGTCTGGTCGGATTTGTTGACGCACTTAAAGACGCCGCGAGTCGGA
TCCACGAGCTGCTCGTTTAGAAGCACGAACCATTCTCTCGAAAGACCACCAGCGTCGATACCAGATTCGTCAAGAAACACGAGCCGCATCGACGAACGGA
TGCTGACTGCTGGGATGATACTGAGAGACTCCATGGACTCTTCAAATAGGTGACTTCGATTGACTCGCAACTTAATCACTTCTTCCTCGGCCGGAGCGAT
GAGCCCTGCTGTGACGGTCACGAAATGCGCGTACTTGTCTGGGAACACATTTGAGGCCAA