Description :
From Genome Similarity Track
Location :
contig_27:634981- 636762
Transcript NameFunction/comments
g7407.t1hypothetical protein

Sequence
1781 bases(100 bases per row)
ATACTGTTCTACTCCGCGACTGTAGTGTGGCTGGTGCTTCTACGTCAGATTGTGGTCTTCTGTCGGTTCTTGACACATTTGAAGCTGCAGGCAGACAGCT
CGAATGATTCGGCGCACACATCTTCACTTGGCAACTACTTCAACAAGCTGTCGCTTCCAACGATAAATGAGCGAGCACGGCTTGTGAAAGCGTTCAAGAA
GCTCCTGTATCGTGCGGTCGCTCGTGGGGACGTTCTTACTGTGGAAACGCTCCTGTCCGAGTCCCAGTCAAAGTACAAGATTGACCATATTCAGGACTTG
TACAGGCCGCCAGTGCTGTGGTTTTACGCTTTCGCGAAATCGAGAAAGAATCCGCTTCATATTGCCGTCAAGCGAGGCAATATGAGGATCGTGCAGATGC
TGCTGGATAGTGGAATTGATGTGAACGTACTCGACAAAGTAGTGCGGTGAACTTCAATGTTGGTCTTGTGTTTAAGATCTTCAGTCGCATCCTGGTAAGC
TGCGAGTGCTATTTGCTGTATGTGCAATTGTACACGACTAATATTTTTTGTGCTTGCACTTGCGTAGGTTCGAACGCAAGACGGAGTTCGATCACCCCTC
AAGACGCTCCTATGCTCCGTTCTCCTTCCTCCACTTCACGGTGCAGTAGCCGAAGGCTACGTTGATATTGTCCGTTTACTTATCAGCAAAGGTGCTGACG
TGAATGCTCTCCCGCGCGCTTCGTTTTACTACCCGGCAGCCGTTCTTCCACCTATATTCGTGGCGGACGACCCGCAGGTGCTGCGCTTGCTGGTAGCAAA
TGGCGCCAACTTCCTTCAGGTTGCATCGGTATCGCTGACTGGTTTGATCCGCACGTACGCAACGCCGCTGCAGCAGAGTACGTTTACATTGAGATCGGAT
CTGAGCGATTACTTGCTGGACTGCGGTGGTGACGTTGCACTGACACCACTTCACGAGGCAGCAGCCACTGATAACGTCGGAAAAATTAAGTGGCTGCTCG
CGCGTGGCATTCACGTGGATACGCTGGGAGAACGCGTTGAAGGTGTGCACCGTCGGACGCCGTTACACTGGGCGGCAGTTGTTGGAAAGGTAAACGCCGC
CAAACTCTTGCTGGAAAAGGGTGCAAACCCCAACGCAAAGGACCGCGATGGCCGCACGCCCTTGCATTGGGCAGCCAGAAACAATCACGATGAGGTAGTC
TCCTTACTGCTCGCTCACAAGGCTGAGCCTGATGCGGTTGATGGTGAGGGCATACCAGTCGTGTGTTTTGCGGCGGAAGCTGAAGGTGTCGATTCGACCA
TTTTCTCTAACCTGGTGGCTGCTGGCGCGAGTCTGCGAACCCAAGTGTCAGGCGGAAACACTGCGCTGCATATCGCTCTGCAGCGTGAGAACCGGCAAAC
AGCAGTATCGCTGATCAAGTGTGGATCAAGTATGATGATCACGAATGATTCGGGCAAGCGCGCTGTGGACTGCACGACGTCTACTGAGCTGCAGTTCTTG
CTTAAGAAAGAAGCAGGAACCCGCAAGATCATGATCTCGTACACTCACACACATGCACAATTAGCGCAAAAAGTTCGCGAACATTTGGAAACACAAGAGC
AGCTCACGTGCTGGATGGATACCATGGATCCTAGCGGAATTGGCGGTGGCGCGGTTTGGCGAGAGGAGATTGCGCGCGGTATCAACAACTGCTCGCTAGT
CCTGAGCATTGTGTGCGACGGCTACACCAAGTCTGAGTGGTGTCTCAAGGAGCTTGCGCTAGCAAAGCTGCTCCGCAAACC