Description :
From Genome Similarity Track
Location :
Scaffold_5:63491- 67280
Transcript NameFunction/comments
Physo_128521hypothetical protein

Sequence
3789 bases(100 bases per row)
GCTGCGTGCGCTCTGCGCTGTCGGTTGATTTGAGTCGGAAATACACTCGCCACAATAGGGCAAGTGCATTGACACAAGTCCATCACGTCCTTTCGTCGCA
TCTATTTCCATCTAGACATCTCGTCATATTTGGCGTGCCGTCCACCAGAAACCCATCATCCAGCATAACCCGATCTTGAAGGGACGCAATGCAATAGTCC
AGCATGGCACGTCGAGCAGCTTCAGCTGCTGACGAAGACCGGCGATTCCGACGCCTCGCGGCTCAGTTGGGCGTCTCGAGGCACGTGTTGGGGACTGAAG
ATGCAGCAGAGGGTGCTGGTGTCAACAATAACGGCGGCGGGCCGACCCCAGAGCGTCAACCGCCAGCGCAACATGAGGCTGCAGACGACGAGCACCAGGT
GCAAGAGGAGATCGAGCTACAGAGGTCGCACGATGGTGAAGAAAACGAAGAAGAGGAGGAGGATGAAGAAGAGGATGCAGGAGAGCTCTCCCTCACGCTA
CCGTCGGATTCAGCCAGCGAGGGTTTGTCCAGCGACCTGTCGCTACCTCACTCGTTCGGCCACTATGACCAGATCCCGACGGGGCAGAGCATCTCGCAAT
TCGACGATCACTTGACTAGGATGTCGCCAGGCCGATTGCCGACAGGGAGGGCGAACAGGTTGCATCAAATGCCACAGGGAACGTCTGCCAGGGGGACGAG
CACTGCGTCGTCCACATCTGATGGCAGCGAGGCGGTGATGAAGAAGTTCTACGAGATTCAGGTCGGCAAGATTCGAGCGCAGCTGGCATTGAGTGTGCAG
GCGCAAAGGGAGTTGGAGAAGACGCTGCAAGAGGAACGCACGAGCTGGCAGGAGAAGACTGCTGAATTGCAGGTAGGCTTAAGAGCTAGCTCAGATCATT
GCTTCACGGTGACAGCTCGAGACTTTTGGCACACTGGTGTGAGCGAGAGAGAAATTGATCATGAATGGTGTAGAACAAACTTGCTGATGAGCGGAGTCGG
TTTGACAAGGAGCTCGCGCAAGTTCGAGCAGATTTGCAGGACGCACAAGCGCGGCTTAAGATGGAGAAAACACACTTTGCCACGCTCCAGATATCCGACG
CCTTGGCGGAGCAGGTTTGCCAGCATCACGTTTCGTGGCTAGTGTCGCTGTCCTCGAGCTAACTGCTGTGTATGGTGTACTAATAGCTATCTCGACAAAA
TGAGGAAGATCTGTCCATTCGCGAGTATCTCCAGTTGTCCATCCACTCGAAAGTGCGAAGGCTGGAGACCGAACTGGAGCAGTATCGACAGGAGATGGAA
AACCTGCGAAGAAGCAGCAGCGCGGACAAAGCTGCAGCCGCCGGTGCAGCGAACGAAGTCGCGCAGGTGCAGCGGATCGCCGAGGCTAAAGAGAGACGAC
TACAGCACGAGCTCGAACTATCCGAAGCAACCCGACAGGAGCTCGAGAACCAAATCAAGACTCTTGTCAGCCAAGTTGATGCGATGAAGGAGGAGCAGCG
ACGCAATGAGGAAATTTTCAGTGACCAACGAGGGTTGCAGAGGGAATCGGAGCGACTAAAGCGAGACTTGCAGGTTCTGCAACGCGAACGCGACGACCTC
AAGTCCCGGTTTGAAGAGATCTCGGCCAGCAGCAGTGATCTTCATCAGAAGATTGGACTGCTGACAGCGGACAAGGCGTTTCTACAGAATGCCAAGACGC
AGCTCGAGGAGCAAGTCGCAAAGTTCCAGACGTCACAACACGAGATGCAGGCAAAATTGAGCTCGCTGCAGGTAAAGCACGACGGCAACCTCAGCCAGAA
TGTGCAGCTACAGAACGAGACGCGACTGCACTTCGAGAAGAAGCTCGACGACGAAATGACAAAGTTCATGGAGCTGTCCATGCGCGAGATCGAGCGGATC
CGCAACGACGGGCAAGTCGTGTATGAGCGAGAGAATCGTTTGCTGAAAGAAGCGCGTGACGATGCCCTGAAACACGTGGAAGTGCTACAAGCAAGACTGG
ACAGCGTTCAGTCTGCGCTTGACGATAAGGTAAGTGCGTTTTAGGCATCTTAGAACTGTTTGGTAAGTTAGTGCTAACTTCACTATCGTGCGGTGGTCAG
GTCCTCGAATCGACTAGGATGGAGAGTGCACATACAACAGCCCTTGCTACTGCGCGCAACGAGCTTAAGATGAGGCATTTCGAGGTAAACCACGTTGGAT
GCTTCGCTTTCGATGCGTTTGTCCTAGCGCTTAGGACGTTTGTTTGTTAACTGTAGATAAGCCAACTCAAGCTGACGCTGGAGGAGAAGGCCACGAGCGC
TCGAAATGCGAAGCTGGAACTCGACATGCTCACTCAGAAGGTAAGAGCCTGAATGGTTGCTTTGTCCAAGTCGGTGCGTTAGACCTAACTCACTCGTCTA
CAGGTTGAGGCCCACAAGGAGGAATTCGCGAGGTTAGAAACGACGTCGACGACATGCATCACCCAGCTAGAAGCTGCCTTGGAAGTAGAGGTAAAGTTTG
TAATGTCTACCAGACAGACAGCATCACATAACCCGTTCGCTTACCATGGAGCTGCGCTGATACAGAGGAACAAGCTGAAGGAGTACGAGTTGCTCGAAGT
TGACTTGGACGGGGCTGTTGTACAAACGGGGGAGATCGCTGCCGGTGGGGCAGACCCTGCAGACGGTGGAGCAGCAGCCGACTCGAAGCTGCAAGAAGTG
ATGACCACGTTTGGAGCGATCCCCACAACAACCAAGAGACGGGTAAGGCACGAGCTGATGCGGCCGGTTTAGCACGACTGTCAATAACTTACACGTTACC
TCTGGTCCTGTGCCCATTCAGTTTCAGCAGAGTGTGCTGCTCGCCCAGCGAGTTGTAAAGTCGCAGCGAGAGGCGATCGCGCTCGAGCAGACGCTCACCG
AGGTGTCCAACGAGCGCGGAAAGTTACAGCAAGACGTCGTCGAACTCAAGACCAAGCTCGCAACCTTCCACCAGCCACAGTCATATTTGGTGAGCTTGAA
CTCGGAGTCTTAGCACTGTGTTCCGTTCGATATGTTCACTCTCACGATGCCCCCATTGCGTTGTTACCCACAGATCGACAAGCTCACACGGCGAGAACAG
GAGCTGCAGGGTGCAACGCGGAGGCACCAGGACTCCCAAGCCCAACTGCAGCAGCTGAGGGCTGAGTACCGACAACTCCAGGAAGCCAACTCGTCGCTGC
AGAGCCAACTCCAGCAACTTTTGTCGCGACGCGGGGACCTCGACGCACTGAAAGCCACCGTGAAGCTGCTGCGAGACCGAATCCACGCCACGAGCCTCCA
GAAGCAGCAGCCCCCACCAAGGAGCTACCAGGCCCCAATGGCTCAAGCGAACGAGTTCACGAAAGCCCGAACAACGAAGGACGATGCAGAGGCCTCCTCT
GTTGACCCCATTGCGTCTGCTCCGACGATCTCGTCGTTTGCCAAAGTATCTCCACCGCCATCGATCGTGTCCAAGATGACTCAGCCACCGACTCCACTAG
GACAGAAGGACGACTTGGACGCTGGGCGATCGGCGTCCGAAGCTTCAAGCGCGTCGTCGAGTATCTCGAGCGCCCCCAGGTGGTACACGAAGCTCCGAGG
TCCCGCTCAGCACCAACAAGCTCAATAACTACGTCGATAACTCCAACATGGCGCCAAAGCAGTTAGTGCGCACTGTATAGCACACACAGGTATCCGTAGC
ACCCTGCCCGAGTAGCTTCCCCCTGCGCACGCATCGAGTCCCTATTGGCCAAAACCTCCATCTTCCCATCGGCGCCACCATGGCCTCAC