Description :
From Genome Similarity Track
Location :
contig_25:63483- 65358
Transcript NameFunction/comments
g6063.t1hypothetical protein

Sequence
1875 bases(100 bases per row)
CTCTCCACCTATTAAAATCGTTTGCCAAATATGTGCTGACCCCCGTCCTCAAGTCAACCCGTTCGGTGTCTCCTTCCGTCCCGTACATCTTACTCTTACC
AGTATCCATAGCCTTGTTGGCCAAGGCATTCGCCATTTTGTTGTGAGTTCTGTAATGGTGTGTCCAAGACTCCACCTCACATCGATCAGCTAGCTTCATG
GTTATCTTGTACCAGTACTGCATCTTCCTCGTTTTCGGCTTCGTCCGCTCCTTCATCATTTTCAGCTATCTCCGACCACGTGTATTCCATTCCACTCCAT
TTTGACTGCCCTTGCCAAAAGTCTATGCAGCCCCGTAAATTCAGCTACGTTGTTGGTGGTAGCTCGACTACCAAGCGCTGTCGCCGCCGCCCACAACACT
ACAGGTAATACCTCGGCGCCCTTGTCCTCGACGATGATACTCCCACTGCCTCCCGCACCTGGGTTACCACGGGAGCCGCCGTCAAAGAACCCAACCCAAA
GCACATCGTTCCTCTTCTCCGGCACTGCGACGAAATCCTTTCTCCTCCAGTGCCGAAGGATTTCTCCTGCAGCCTGTATCTTGGTATATGAAGCGGTAGT
CATTGGGTACAGTCCCAAACGAAAACGCTCAAAGGCTTCCACTACACTTGTCTGGTATCGTCTGAGTTGGTCCGCAATCGCTGCAGCTTTTTTCCTTCTG
GGTGAAGTCGATCCACATTCCATCGCCACAAAGCGGTCAACGTAACCGCGCAACCGAAAGCCCACATGGAGCAAGCACTTCGGTGACTTGATCCCATGGC
TCCACCTCCTGCTCGACACCCCATGTAGTTAACCACCCCGGCATCTTCTGCAACTTGAACCCGAACATTTTCATGATCGCCTCCTCTTGTGTGTCTTTGA
TTTCCCATCTCATGCACTTTGCACCCTCCCATTTTGCACAGTAGAACCTCAAGTGATCTTGCGCCTCCTCGCAGTCCCATGCCAAATGTGCCGATCCCAA
TGTCTTGCTGTTGGTGCATCCAGCAGCAAGGCACTTGAAATTATTTTCTTTGCCGGCCCACAGACGAAGCCTGTTGTTCTTTAACCGTACCACCGTATGA
GCTTGATAGGCGGTGACGCCTTCCATCCTGTGAATCCTCTTCCATTTCAACTACTCTAGGGCCCGGGCCATGCTAGCGTGATTCGCCTTCCACGCCTCCC
CAATCTGAGCTTCGGCCTTGATCGCTGCTGCCTCTCTCCGTTTACCAATGAACTTCTTGTAGGACTACCTACTCTGCTTCCATCTCCGCTTTCCAGCCCA
AAGCGGCCTCATCCGAGTCAGCCATGGGTGGGGCAGCACCCAGACGGACGATGTCTCCGCCTCCAAATAGTTGGGACTCACCCTTTGTATCTATGGTAAG
GCCACTTAAGCTTGAGAAAGTGAATTGCATTCTGGTCGGCTATGGGGACCTACCAGCTCGCTGCCTGCTTCCGTGCTGCTCCTTGTCCTCGTGGCGCTGT
CGCCCAGTCACATGAGCAAGAAGCGCCTTCGCATTCACCACACGTCCTTGCTTCAGTATCACCTTGTCCTTGTAGCGCCTCCCATCGTTTCTTCGCAGCA
CTGCATCTCCTACAGCGTCCTTCATCACTTCTTGGCGCACCGCATCTCCTGGGACATCAGCGTCTCGTTGTTGTTGTTGCTGCTTTCTGCTATCAGCTTT
GAGAGGTATGCTCCACAGCATCTGACGACGACGAGACAGAGGTAGCGACCCCTGCCTCACCGGCTTCATATCTTCCCCGGTCTCTCCTGTCTACAGCGCC
TTAAGTACCGGTATTGTCAACGAGCAACCGCTTGGCCGCGGTAAGCGAAGCCGAGCCAGAGTTGCTGACGTATTT