Description :
From Genome Similarity Track
Location :
Scaffold_377:6347- 9862
Sequence
3515 bases(100 bases per row)
CGCTTGGGGACCGGATCCACCTTTAGGAGTTTATAGTCATCTTCTTTCGGTACCGCTTCAATATTACTCGGGCAACGGTCTTCTCCTTGATTGGCTCTGC
GGGTCCCTCTTTCCTGAGGGTATAACCATTTTCGTGAATTCTTCTCTCCCATGCGCCCTTTCCCTGAAAGTCCCCCCCTTGTCCTTTCGTCATGATGGTC
TCTGAGTCCATTATAGTTTCGGAAGCACTTCACCATAGCCGTTCCCTACCCTTTTTCAACCGGACAGCGGTTTGAGCAAGCGCATGTCTTCACTACCCCC
ATCTCGTAAGGTGTTGTGCTTGATCTTTGTCAGTAGGTCTTTGTATGATCAGTGTCATTCCAGCCATGTCTTCGCCCGGTCGTACCCCCCCTCCGAATAA
CCTCTCTCGGTCGACTCCACGCCAGTGGTCGACCCGCCGGCCTTGGATGTCGTTGCACCCTTGGTGGTTTCGTCATCGAAGACACACGCACCTATAGTCA
ACCCGACCGCATCCGTACCAGTCGTCGGGCCGTTAAGGTTACCGTTATGGTGCCGGTGTCGTCGAGATTAGCCATATCAAGTCATGAAAAAGGTTAACCT
GTTTCCTCTGCTTTATCAGCCACTTCGACTGGCGACCCAGTTGCTTTCACTCCTTCGGCTGCCACGACCATGAAATCATCTACTACGTAATCCAAACTTC
GCTCCGTGCGACGGACCTTGTTCAATATGCAGGCTGTCGTGACTGCACAGAAACACCGCGTGGAGGCTTGTGAACGCCGTCTTGCGTTGAATTCTCTCTC
CAGAGATAACTGGGTGGCCCGATGTGGATGACTCGAGGACGAGCTGCGTGACCGCTCCAGCCTGGTGGCCCAACTCCGCAAGAATTAAATCATGAAGTGG
CGATGGTCAAGCATCTGCAATGGCGGATTAACCACCAGCAGAGCCGGCAGACTATTCTCGAGGCTTATCTGGACTATGCCTACGCCTCTCATGCCCCTGG
CAAGGACTTAACCCTACCCAAAGTGACCGCCTCACCTAAGGGACTCAGATTGGGGAAAGGGCCAACTTCGGATTCCCCCCTTTCCTTCTAGAATTCAGAC
AAACATCCCCGTTGGAAATCTACCCGAGTGTCCGCCTCATCGAGAAAGCCTTCGAAGCTACTCGCATCATTCACCCCAGTTTCGTCGATGCATCCTTCGG
AAGCTTCTGGTGCGCCGTAGTCTACGGTCGAGTTATATCCTTTCGATGACGGCTCAAGTGGGGACAGTGAGGTGGTGCGGGCGACCTTGGCTAAGTCGCG
GTCTTCTGATCACCGCCACACTATGGTTGCAAAACCTTTATCTTTGGCGCAGCCCAAATGGTCTACTGGTTTCCCGACCGTCAAGTATCCGATTCAGCCT
CCGAGTCATTCGGTCGCCGCGTCCGCCGCAGCTTCGGCCATGGGGTCTACATTCACCCCAACAATTTCGCTGAAACGGGCGATTTTCAGGTCTTCGAACT
CCGAAAACGAGTCGGTGTCTGGAAAGAAGGATACCCCGGCGTCTGTAGGTGGTCCTGATCCGGATCCGGCACCTGACCATTTGTTTCCGCTCGAGGCCAT
GATCCTTGGTCTTATGAAATCGAATTCTTAACCCCTGTCGAAGTGGTACTGTGGCTCGCGGACCTGGTTAGCTCGTGGAGCATCGTAAGGATGAGTCCGA
GCGACCTGTTCTACCACCTAGACATGCCTTGGGGATGTTTCGGTCCCTTCGATAGAAATTCTGACCGTCCATCCAATTAAATTCCTCCTTGGCCATTCCC
GCTATGGTCAGGGGCTTGCTGGTCGCCGTGCCTTGGGTTTCCGACCGAGCTCCGCTCCTTTCCATGTCGTTCCAACCGGTAGGCGGGCTGGCCAAGTTGG
TTGCGGGATACGAGCGGTTTGATAAGGACCGTAGCCAAGCACTCTGGGAGTCGACACAATCCTTGTGAATTTACAAAGAGCAAGCGCGCACGAACCCGTT
CCTCGCGTCATATTACAACGCGCGGAAGAAGCATCGGGGTCGAGAGGTCCGAGCGCGTCGGGACGTGGTCGGTTTAATTTTCAAGGGGATGAGTCTCAGT
CGATGCGATCTCGACATCTTCTTGGCCCACTTCTTTAGCCACCTCACTTTTCCTTGCTGTGTAGTGTATTGATGTCCGGGGCGTGAGGAGGGGTCCGTTT
CGGTCAACCTGCTCGAGCGTCTTAAGGTGTCCGATTCGGCGTTTCCATGGCTTACGCAGTACCGATTGTTCTCGGAGCTGCATCCAGGCACCTTGGTTCC
TCGCATCAACAACAAGTTTGTTCCGTCCTCTCAGGTTTAAGTCCCTTGAATATACTTGGTTCATTTTCTCTTTTTATCATTACATCTTCGCATCTTGGTT
TATTCGACCACGACTTGGCCTCAACATCTCCGGTCGACCTCTAAGAACCAGAGTCTACTCATGAGGGACTGTGGTGAAGTGGTCGGGAGAGATCCTGAAT
AATCGCATCTTTTCACATCATGGGTACGTGTGGGACTGGTCACGCCGGCCTTGGGACTGACCGCTAAAAATCTCCAACGGTACGGTGGAAAGTTGACAAG
TCATCAGTCGCGGTCACAGACGGTGACCAGCGGTCATAGTCACTATAGATGACCAGCGGTCATGCTGGCAGTTGAGGTGGGTCACTTTAAGCACAGAGAA
TGGATGGCGGGGAGCGAACAACGTAACAAAACCTGAGATACAGAGAAGTATAAGCGTACTTCTAGCTCCTAAAAGGTTAATAACGAACAGTATTTATTTT
CCTACAAAGACACGCGTCAGCATCCCTCCGGGCTGGAATACTTGTGGCCACCCGACGTTCAAGGTTTACTGCTCACGTGTTGTTCAAGGTTTGTCCCTAG
AAGGAGGTTGCCCGAGATAAGGGGTATGATAAAATGGCACCTGCTAGACTGTGAAAATTTGGGATTAGATACTCATTCAAGTTAGCCCGCGATCGGAAGC
GGCAAGCATATAAAGGCAAGGACTGCTCAAGTGATCAAAAGACCAAGGTGATCGAGTGGTCAGAAGAACAAGGGGATCAAGTATCCACATTTGGGCAAGG
TGAACTCAATGCAGGGCGAATCTGGGAGAGCGCCACAAGTAACCGTTGGTCATGTGAAGGGTTTCCACACGACCACACCCCACCTATCCCCAACTCCGTC
AAGACAGACATCGACCTCAAGCCACCTAGAAGAGTTCAACCCGACCGCCGACGGGTACACAAGTTGAGAAAGAACAAGACAATACACACTGTCCGGAGTA
CCCCTTCGTTAGTCGGTCGTCCGGGTGCCAGTGGATAGTTGTATCGCTTTGTAAAATGAGCGAATCTCACTCCACCATAATGGTCCGCGTGCCCGGAACT
TCTGGTGACTCGGGATTTCACCGTGAATCCCAGAGCGAAGATGTCAAGGTCAAGGTTGAACAGGGGATGTAAGTGTAGGCGAAGAATGGATCAATGCAGG
CACGTGGTCATCAAG