Description :
From Genome Similarity Track
Location :
Scaffold_51:63443- 64534
Transcript NameFunction/comments
Hyaar_Emoy2806487PREDICTED: uncharacterized protein LOC100207802

Sequence
1091 bases(100 bases per row)
TCCGTCATGGTTTCCATCCATCCCCACGCAATGACCGAGATACGACCTTCCTCTCGTACCGGCACATCTTGGAGAATGCCATGGCGCCAAATCACGTTTG
TGTCTTTCGAAAAGGCGTAGACGCATCCATCCGGCTGCGGCACACTCACGACGGTCTTGGTCTTCGCATGCTCGAAAGCAGCGTCACGGGTCGCTCCAAA
TGAGATGCCAACTGTAAAGTTTTGAATGCCGGCGAGGTGGGGCTTCACAGCCGCAGCATCAAAGTGAAATGGCTTCCACTGCGAAGTATCCTTGTACCAG
TTGAAGCGAGTGGCTTTGATGTCGAGATTGAAGAACTTTTTCAGTCTATCCGTGACGAGGTCGAACGTCGGACACTTGGCTTTCCAGCTCGACCGGTCGT
CTACAATGAGATGCGTGCCGTCAATCTTATCGTTGCCATGCCACATCTTTAGCAGCTGCTCTCGAGGAATGCCGCAATTGTCCAACTCGTGCAGGAGCTT
GGTGTACAGCTCGCCCTTTCTGTAGTCGCTGAAGAGGTTGGGCACGAGCACGACGTCACGCGACGTCAGAGGCGTGGAGAATTGAGTATCCTTCGAGCCC
AGATCAAACGTGATGCGGAGATCGACAGGCTTGGTCATCGGTTCAAAGCTCTCGGTGTTTTTCTTGCTAGGCTGACGCTTGTCATGTTTCTTCTTTTTCT
TGGACTTCTTGTCGTTTTCCTCGTCCTGCTTGTCAGAATTGCTAGCATCCTCTTCTTTCGGCGTGCTGATGGTCGACTCGCGATCGTCTACCTGATCGCC
CTTGGACTTCTTGTCGTTACGATTCTTCTTCTTCTTTAGAGTCTTCTTGACTTGTTCTGCTCCACCCGAGACAACTGACCCAGCGCTTTCTTCCTTCTCT
TCAGCTCTTGGGTCGAGCTGCGTCAGAAAGTGGTTTTTGCGGCACTTATCGCCGAACTTGCACTCGCCCCTTTTCCAGAAGAACTGACACAGCATTTTGT
CATGGACATAGGTGCAGCCCACACGCGTGCACTTCTTGCGCATGAACGTACGACATACGTTCTTGAAAAGACCAGCCTCGTCATCAAAGTG