Description :
From Genome Similarity Track
Location :
Scaffold_21:63434- 64917
Transcript NameFunction/comments
Albla_Nc140252506phosphogluconate dehydrogenase putative
Albla_Nc14025260conserved hypothetical protein

Sequence
1483 bases(100 bases per row)
TCTTTTTTGGTAAATATTTTGGCAGTAATTTCGATCAGAAATGACTCTAATTCGCTTTTGTTCCAGTCCGCAAAGACCTGAGCCAATTCGGAATTACTGA
GTCCGCCAGCAATCTTCAAAATGTCATACGTCTCGGCAATCAGCTGCATGTCACCATACTCGATTCCATTGTGAACCATCTTCACATAGTTCCCACTTCC
AACCTCACCCAAGTACGTGGTACAAGCTCCATCATCGACTTGAGCCGCACACTTTACCAGAATTGGTTCCAATGCATCGAAAGCTTCTCGTGGTCCACCA
GGCATTAAAGATGGACCATTACGTGCCCCTTCCTCCCCTCCAGAGATTCCCATGCCAACAAACATGATCCCTCGAGTTTTCAGCTCTTCAGCTCGGCGGA
TGCTGTTGGGGAACCATTCATTCCCACCATCGACAATGATATCGCCTGCTTCCATATGCTCTGCGATGATGGAAATGGTCATATCAACAGGTTTTCCAGC
CATCACGAGGATAATGACTTTGCGGGGAACAGAGAGCGAGCGAACAAATTCTCCAACGTCTTTAAAGCCCACGAGAGGAAGATCTCCCTCTTGTTTGGCG
CGTTCGACTGTAGTGTCCACTTTATCGGGTGAGCGATTGCAGACAGAGACACTGAATCCGTGGGAGGCCATATTCAATGCGAAATTCTGACCCATCACAG
CCAATCCATACAGCCCGACATCGGATAACTCGACCATCTTTGGCTTTTCGATAAATGAGCAATGTCGGGGGAAGAACGCGGTAGTACCGTATACTTCTTT
ATTTACGTACCTTCGAAAAACCCTGGAAGGTCTCTCCATCCAAACGATTGGGTAATATACCCCTCATCACTGCCAATCAATAAAAAGTGCTCTTTAATGC
ATTTCCAAATCACGGAATCGCACGCTCAAGTCGCAGCCTCGTTACGCGTCAACTAGGACATGTACAGCATCACTTTCACACCAAACATAATCAATTACAT
CACATCTAAAACCCCTGCAACGGATACATCACAACATGCTCTCTGAAAGCGCGTAATTTGCTTATAAAAATACCCTCATCTAACGAGTCAAAGTTCCTTC
CCACCTCCACAGCCAAGTTCTCTCTCCTCATCCAAAGACATCGTCCGACACCCATCAAACACGTCGCTATACGCTCCCCATTCGCTCCGATTCCCGCCAC
GAATTCGAATGGTATACTGAGTACCCGCCTGAAGATTTGAGATTTGATGCTTGAGCGTATCTGCCGGTACAATGTCTCTCACTGTGCGCCACAACGCTGT
CAATCGATTCTTTGCATACTGAATCTGATACATTGTGATTCCCACATCGCTAATGGGCTCCCACGTGACAATCAGGCTGGTAGAAGAGACTGCGAAGACT
TGGAGAATTCGCGGTGGAGCCAGTTTGCCCGGTTTCTCAGAGTCGGAATGATCGTTACATTCGTCACAATCCGACCCGGAACC