Description :
From Genome Similarity Track
Location :
contig_24:634325- 652046
Transcript NameFunction/comments
g4653.t1hypothetical protein
g4654.t1hypothetical protein PHYSODRAFT_263158
g4655.t1hypothetical protein PHMEG_0001107
g4656.t1hypothetical protein

Sequence
17721 bases(100 bases per row)
TGGTGCATTGTTTACAGTTCATGGTTCGGGAACCGAGAGAAGCAAAGTATTGGTTCACTGAGGAGTCCTCGTAGCCGACACGGCATTCTCGTTGAAAGGA
TAGATTGTCCTCTACGCCGAGTTGTTGGTCGTGTTCATCATCCCACAGAGGCACTTGATCCGAGCAGGCAACATTTCTTCCGGCATCAAAGGTGGACACT
TCAAGGGTCAACTAAAAAATCCAGCTAACGTTATAGTTTACGGTCATTTATAATCCAATCGGATTACGGCCCGAAAAAGGTAGGTGCCTTTATCTAGACA
TTTCCATGCTATTTTCCTAAAACCAATCTTTCCGGGCCGTGGGATCACTGCGAAAAAAATTCAGTCGCCGACACGTGCGGATTAGGAGACCCACGCAGCT
CTCAATGGACGGCGACGGCGCGGCAACGCCCGCCGATACAGCGCCTCCCGCAGCGTCTGCACAAACCAAGTTGTCCCCAGCAATGGCATATCTCCACGCC
TCCCAATGCGTCTCAAGCACGAACGGATCGTCCGCAACGCTTCAGAGGCTGCGACACGTTCCCAGCCCGCTCAAACCCAACCGAAGCCTCAGCTGCGAGC
GCCGCCCAGGCGACTGCGAAGCGGCAGCGGGAGCGGCAGCAATACAAGCTCCAGCGGCGTGCGACGCGAGTCCCGGACCGTCGACCCGCCAGCGCCAACA
TGGGCATCGTCGTGGGTACACTGAGGACGCAGGAACCGGGTGACGCTACGCACAAGTTCCTTGTCCGACGAAGAGGCCGACGATGTGGTCACTGCGCCGC
CCAGAAGCGGTGCGAGCTTGGCACCGAGACGCGCCAAGAAGCAGACGAGTCTGCGCAACATGGCGTCGCTCGTGCGCTCGCATCTGCGCAGCTCCAAGAG
TATCTCGTCTACTAGCAATGGCAGTAGCAGTGCAAGTGGAGAGGCAGACTTGGACGCAGACAGTGGAGGACCAGGACTAGAACGCAGCAACTCGTCGTTT
GCGGGCGTCGCGCAACAACTCGTGACGTCCCGACGTGCAGCCAGAGGGTTTCTGTCCATGTGGACAAAAGACTCCACGGAGACCATGCACGTGTATCGCG
GTATTCACATGGAGAAGAAGAAGCTGGACCTCGTGAGCGTGGCCTCCGAGTACAAAGAGATCAAGCGTCGACAGTTCTACCAAGAGCTCGTGGTCTACTT
TGTCTTCTTGATGGTGCTCTTCTCGCTGCTGTCGTGGCTGCCCGTGCAGGATAGTTTCCACCAGAATGATGTCGTGGGCGCCCTAATTGCCGGGAAGAAG
GTGAGTGCGAAATCAAGACCTTCGCTGACATTTACGAGTTCGCTGGGAAGTTGAGAGAAGCCGTGTGTGACCGAGATGGCGTCACGGCGCAATGGGTTCG
TGTTGGTGGAGTGGGTTTCAGGCAGGTGCGCGTTAAAGAACAACGCTGCCGCGTCTACGAAGGGTGGGACGCGCCGTGCTACCCGTTTTACAGCCCCGAA
GTGGAGCAAACGAACCCTTTGCTAGGCGAAAATGGCACTGACCGCTCGTACGTGTGGAGGGATGGTCTCGGCGAATTGTCACCGGAGCTTTACCGATCAG
TTGTGGACTGGTTGATCTACGCTCCCGTAACGTCCTATGGCTCGGGTGGCTACGCTGTGGATCTGTGCGATCTAAATGATGTGAATGAGCTGCAGAGCGA
CAACTTCCTCTCTGAGCACACGCGTGCTGCAGCTTTCAAGTTCATTTTGCTGAATCCGGTCACCCGCGTCTTTACTATTGGAATGCACGTATTTACAGTG
GATCCGTCTGGGCACCTAGACCACTTCGCACACAGCTCACACGTGCGAGTGATTGGGCACGAAAAGTCTGAGCAGTTTGCACTTGATGATGTCGAGAACA
AAGCAACTATTCAGCCCAAGCTTCACAAAAGGATCTTCAGTGCTGTTGGCAGCACGCTTTCTTTGCTGCGTGATGCGTTTGATGTGCGCGTCTTACTCTG
GGTAGCGCTGTTGCTGTTCTTCATTACGTACTGCATCGGTGAGGCTACTGAAATGAGTACGATGGGTGCGGCCACATACCTTGGGTCAGATATGTGGAAT
TTGTTCGAGCTTACACACTTGGTGGTGTTGGCAGGGATGCTGAGCTATATGGTGCACTACTATATAGCTTCAAGCAACTTTGCACTCCACCTCGAGGAGC
TGCGTGAAGGGCGTGGTGTGGAAGAACTGAGCCACTCGAATTCTCAGGAATTGTTGACAGTGTTCCAGCAGCTTTCCGACCTTGCTTCACTCGGATCTGC
TATTAGTTTGCTCAAGGTGTTCAAGTTCTTGCGCATGAATTCGACGCTAAACCTCCTTTGGCGAGTTTTGGGCATGGCTATGCGCGATCTAATGGGGTTT
CTCGTCATTTCAACCTCATTTTCCTGGGTTACTCGGCTATGGGCAGCTATGCCTTTGGTTTTGCTCTCGAAGAATACTCAACTATCAGCAAGTCATACGG
CACTTGTTTTCAAATGCTTGCCGGCGAGATGGACTATGCTCGATTGCGCCAGGCTAACCCCCGTGTTGCACCCCTCTTCATCGGCACCTTTGTTGTCTTG
GTCTTCCAAATCCTAGTCAACATGTTTGTTGCAATTCTGTCGGAATACTACGAAGTTGCAAAGAACGACGAGTCTGGAAGTGGTGATGACGTCGAGTACG
ATGTTCTTGCGCGAATCCGCAGCTTTGTGAGTGCATGCTCACCGACAGTCGTCGTGCCGAAGGACCATGGAGTTATCCGTCTCATCCCGTGGCAACAGGT
TCGTTTGATCTCAACAAACCTTGTCGACCAGGAGGAGACCCGTCAGCGTGTCAGAAAGCTTTTTCGCGGGGCTGTGTGGCGTGTCGTCGCTCTGCTGCGC
TTCGGAATGAAGTTTGATCGCCGTATTAACTTTGGTGACCGCAAGACTAACAACGGCAGTGGCTCTCACGGCGGCGTTGGTGGGGGCTCCAGCAATGGCA
AGGATGAGCGCGAACTCGTATCGCATATCCGCCTTTCGGAGAACTTTGATCACAAGACTATTAAGGAAATGATTCCGATCGGCATCACTATTCGACTGCA
AGGGGATTCAATTCTTGGCGATGGACTGGCGCTCAAGGTTGTGCACCACAGCAAACTGTCGGTGGAGTGTGTTGTTCTTGGTCCTAACGACCCTGAAGGG
ACTGCTAGGGTAAATTCTGCTGAGAAAGTTGACGGCTCACCGAATGCATTCGCACCTCCCCGCTCAATATCGTCGCTAGGGTCATTCGAGGACGAGTCCG
ATCTCGATGATGGTGCTCCGCGTGAGCGTATTCTTGAGCTGATGGGTGGCGAAAAATTGCGGATCCCCAGGCAGCGACTGGCAGTCCATTTGTGTCGCAC
CATGCTGCAGGAGCTCAAGATGGGGCTATTGCGTGCAACGAAGCTGTGGAACTATTCGAAGGATCACATGGTGGATGACTATCACCTCGGTCTGCTATTT
GATAGTGTTCGTGCTGATGGTCGTACCAGTCTTCGTTTTGACGAGATCTCACGTATGCTAGACCTGTTCCTGCGCAAGGATAAGCGTAAGGCACTCTGTT
CGCAAGCAGAAGTGCGGCGTGAGGCTCTTCAAGTGATGTACCGATTCCGCAAGTGCCTTATCGATATGCCATCACGTGAGAAGGAGGGTCACAACTACCG
CCCGAAGCCTGTTGACACGTCCAAGGTGGAGCTAGGTCACCTCGAGCATCTTGGTGATGTACTGGCTCGCAACTGCCACGATATGTGGGCGCTCGAGCGC
ATCAAACAAGGGTGGCAGTACGGCACGGAGCGCGATGACAAGAAGAAGAAGCACCCGAACCTTGTGCCCTATAAACTACTTTCCGTGGAGGAGCAGGCCT
TCGACTACCGCTCATCTATCGAAACGATCAAGACGATTGTGTTTATGAACTACGCCATTACGCGTGCGAACCACCAGCGCTCACACAGCGGCTCCTTCCA
TGACTCTGTTTCCCGGTCAGCGTCGATGATGTCAGACATTGCTGAAGGCATGGGCGGAAGCAACAGCTCACTGATCAGTGGCGGCTCGGAGTCTACAAGC
CCACGTGCTAGCGATGCCGCTGTTTTCGAGGAGCTGGGCACTGCCTCTCACCCCGGTACGCCTGCTAAGCCTGTGCCGTCACTGTTGCGCGAAGCGATGA
GCTTCCGCCGCAACAGTCTCATGGGCGATTCGCCGTACTTCACGACGTATGGAGATGGAAATGTCGAGGTCTATCGGCCTCTTCCTATCGACACGACGAC
TGTGGAGCTGCCTCCTAGGCTCTTGCGCCTTGTGGACCTGCTGGCCGAAAACGCACACGAGGTCTGGGCTAAGGGACGTATGGATGAAGGTTGGACCTAC
GGCCCTCAGCGTGATGATGGTTCGAAGAAACACCCGTGCCTTGTGCCCTATGTGTTCCTCACGGACGATGAGAAGGAGTACGACATCAACATCGCCAAGG
AGACGCTCAAGACTCTGATCGCGATGAAGTTCACAATTCTCGACGCTCCAGCAAGTACTAATCCTGCAGCGATTTCTACGTTGGTATCGACACAGGTAGC
ATACACGTATGCAAGCTTGGGGCCGCCACTACTGTGCGCTTTGGTGCATGGCTCGCTAGCAATATTGAACACTTGGTTTTACGCCAGATGCACTGCACTT
CTTGAGGTTCTTGCGGAGGGTATGGTTGGTTTTCGCGTTTTACTTCGATAGAAACAGAAGATTGGCTTGGCGAGGTCCACGGATTCCGTAAGAGCAGAAG
GTGAGCCTCATTGCTGCGTAGCGTCATTTCTGAGTAGTATCATAGCATTTGTTCGATGCCATCTAACTCATATTGTCAGTCGACAGGCATCTGAGGGGCA
GAATATGAGCTCAAGTGATCATCCTAATATGCTGGATGCATTTGCGTGGTTTGTTTAATATGCCGCCGATGGCTAGTGTCTGGAGCGGGGAATTGATGGA
TACATTGCATATGCAATGGAGTTACTCCTCATCAGGGGCGTCCATAGAATGTCGGTGGCTGCCTCAATGGTGAGGCAAAGGCGAACAAGCTCGCGACGCA
CGGTCATTGCATTGCCGCGCTTGAGTTCATGCGTGACGCCAGGGAAGAGACTCACGCGATAGTCATCCCACTCGGAAATGCCGTACAGCACCTGGAGACA
AAATAAAAGAGGGTGCAGAGGATTAGTGGGGGGATTCATGAGGGTTCCAGCTTGGAAAACAAGAAACTTACATTCTTGATCCAAGGCATGTACGTCAGCC
CCGAAGGGAGCAAGAACGCACGCTGAGCACGAAGCAGACGGTTGTTCACCTCCCGTACGCGACTGAAGTCAAGCTCTTCGTTCGAGATGACATTCATTTC
GTGACTGACGCTGAGAGCAGCAGCTTCGAAAGCGGTGGTGGCATTGTGCAGACGAACGAGTGATACCGAATCGGCTAGACCTTCACGTCCAAGCGCATCC
TCCAAGAATGCCTCGCCACGCCGCAGCTCACGGATAATTCGGTGAAATCGTACTGCAGAAACTGCGCGTCAGTGAAGGACAGGAGGATGCTGCCGTAGAG
CTCAGCAGCGGCGCGGTGGAATGCAAATTGGGGGTCAGCGAAGTGTGAGATCCAAGCAGGGGTGTCCGCGCCCGTGTCTCCTACTCCAAAGTAGCCTCCG
TCAAAGCCAAGCTCGAGCGACGGTATGCCCAGCCGCCCAAGGAATGGGGAGACACGTCCTCCGAGGGAGCGATCCATAGGTGGCAGCTCCAGCTGGACAT
CGCTCGGGTTCTTCTTGTTGGCATCGTCAAGCCAGTATGCGAACACGGAGTTCCCACTGCCTTCAGGGAGCTCGTTGCTTGAGAAGGTAGCATTGATTGG
CAACATGTCAAGATCGTCTTCATCTCGGCTGGAGCTCCCGGCGGCAAAAGCTGAGGCGCTGGATAGGTTGTGGAAGAAAAAGCTCGCAACGTCAGGGAAG
GTCTGCTTCTTCGGTTGAGCTACAGCAGTCATGAGGTAGATGTTCTTGCGGATCGTAGCAGAGGCCTTGCAGCGAAGTGCGCCAGCGCCGCGCACAACAT
CATCCAAGTGCAGGTAGACGACACCACGCCCAGCGTTCCCACTCCCGAATCCTGGGTACCGGTCGATCCAGTGCGAGCTACCAACCGAACCAAACTGTTC
GCCGCCAAACGAGGCGAGGACCAGCGTGCGGTAGGGGGTCCATCCATTTGTCAGGAGAGTGCCAAGAGCTCGTGCAACCTCCAGGAACACCGCGTTTCCC
GATCCTGGGCTAACCGCGCCGGCATTGAGCGAGTCACGCGGAGCACCCACGAGCACATGGCGATCGGGTTCGCGAGAGCCGTGCACCGTGATCACGACGT
TCCATGTCGTTGTCAGCGAGTACACATTGCGGTTTGTCATTTGAACGACAATGTCCGCTGCTCCCGATGAGGACGTGGCGCCATCTACTGGGAGTGTGTA
CTGTACGCTCAGCGCACCACCCTCCCAACGCGCCCCGAACACGTCCGCAGCTTTCACAGACTCGAGGTCAGCCACTTTGTCAGCAGCACTTTCCATTTGA
GCGAGCAACTCCTGAGCCACCGCGGCGCTGATGGGCATGCTGACAATGGGCGGGAGGATGTTGAACGTGTTGTTCGTCGAATAAACATCGTCGACGGAGA
TGCGATCGGCGTTGGTGCCCATGGGCCGCGTAGCCGAGAAGCCTTCTGGCATGGTCGGATCGCCGTCTCCCATGTAGACGTTGCGAACGTTGTCGTGGTG
CTGGGACGCCATGGCCCATCGGGTGCTGTGGGTCCTCGAGCAGCTCCATCGTCAGCTGGGTCACTACACAAAGGCACAGTGTTAGTGCACACAGTTGCTG
GACGAATACACTCGACGCTGGGCACTTACGTGTATGTGAGCACACCGACTGCACCGAACTTGGATGCCAAGACAACCTTAGCTGGAAGAGATACGTCACC
GCCCATGCGAACCAGCACGATTTTGCCAGCCACAGACACGTTGTTCAGTGCCAGAGCATGGTAGTCCTCTGACGCGCCAAAGTGAGCATATACAATTGCT
CCTGATACAGTGCCGTTCTTGGAGTACAAGTGGAACGCAGCGTGCGGCTTCGTCATGTTCTTGCCCTTTGCCTGTCGCTTCGCCTGTCGAGCTGCGTGTT
CAGCTACGAAGTCGTACGTGGCCAGCGTTTTGTTGTCGGACTGCTGAAGAATATCTAGGGTGAGCGTCTCAGGTGCGTTGATGAGCATTTCGAACTCGTC
CAGCTTGATGGAGCTCTCTGCAAAGCCGAAATCAATGGCTTGTGCGCGAATGAACTGTGCCATCTCATAGTCTCCGGTGGTGCCTGTGTGTCGAGATACC
TATTGTGTGCACAACCACCCAGTTAATGATCAAAATGCAGATGCTCGCTGCCGTCAGACGTACGTTGGTGTAGAACTCGAGGTTCTTCTTGAATCCATCG
GCCGATGTGGCAGCGATGAAGTGGTGTTGGATGGCTGGCGTCGAGCTGTACACAAGATAATACAGGCATCACCAGTTAGTGTTCGCCTGCATCGGCATGT
ATCTTCGTTACGCAAGACTTACCCGTAGTTCTCTTCGTGTCCGAGAATCCCCAAGAGCATGACGCAAATGGAGCTGGCAAGAAAGAGTGCCGTCACGAAG
GCGATTCCGACGCGGCGACGAAGCACAATCTCCTCTTCGCTGATGCCTTCGCTCACTTGGACCTCGCGCGGACTGTCGGCGTACACGTTCGACCTCGTCA
ACGGCACCTTGGACTCGTCGCCACTGCTATCGCCCTCATCGAGGTCGAGATCGGGGAGCACCTTGAGTGCATCGCCCTTGATGATGCTGGCTCTGTCTTC
GGAAGAGCCCATTGCGACCTCAACTGCAGCTAGACGTTGTTCTGAGCTCCGCTAGCTGGTTTCAGCAATGGGTGCTCCGCCAAGACCAAGACTGCACTCG
ATCGCACAGCCGTCTATCCTCGGAACTGCACTACGCACGCTATTTTTTGCTAGCAAGGTGAGATCCTGCGCCATGCTGACAATGAGGCAGCAAGAATAGC
ATCCGGCCAGCTCCTACTATTCCTGCTTGAGCGGGCATCATGCTGAGACTCGCCCGCTACCATCTGACCGACTTCAACTTTGGTCGCCACAACCGGCTTT
CTGCTTGGATCAAGTCGGTTCCGAAGGGCTCACTTGGAAGTGCGCTAGACACGCTGGAGGGAGTCCAAGCAACAGGACGATCATACTTTTTCTTGGGTTT
ACATGTGCCACGCCTCTGGTTGGCGTGGCACCGTCCTCTGCTTCGTCGAGGGACACTCGCTCGTGTCTGATCCCCGTCCTAAAATCTACACTAGTTCACA
AGTAGGAAGGCGAGGCCTGCCTTCAAGTCTCGCGAGCTGTCCAGCAGCGTCGCGGTTCCTTCCTCTCCTCTTGTTTATTTTTCTTGTCATGTTTCTTCCA
TCAAAACACTCACTCACTCACCGCGCGCGAGCTCCACTCCGCTCCGCTTTCAACTAAAGCAGCTGATGCTTCGCACTTTCTTCTTCGTTTGGCCCTCGAA
CATGCTCTCAGCCTGGCGAGTAGCCTCAGCCACGATAGCATCAAAGAAGGCCACACCGTCCTTATCCCCCGACATGCCCTCCTCCACAACCGCCACCGCC
TTGGCAACAACCAATTCCAGCTGCGAGGGCGACGTGAAGTCGCCTTCGCGCTGCAGCAGACTGCCGATCTCGAACAGCGAGAACCCGGCCTCCGCTCCAC
GCTTCAGCACCGCCGTACACACACGCATCGTCGTCACGCACTCCTCCTCAATCCCAACAGCACGCAGCACGGCCGCATCGCGCGCTTCGTCCAGCGACGC
GATGTGGTCGAGCTCAGCACACGTAAACGGGAACTCGGCCTGCGGCCACTGCAGCCAGTCAAACGTCGCACCGTCCAGGTGCTTGTAGGATGGCAGGCAA
AAGCCGTGGTCAATCGGCGTCATACCGAAAGTCTGGTCGTTGGGCCGGGCGCTCAGCAAAATGTTGCCGGCGTGGCGGTCCGTGTTAAACAGCCGCACGT
CCAGAATGCCGATCTTGTGCACCTCAGGGATCGCGAACTTGAGCGTGCCCATGTCTTCAGCTGAACATTGCGAGGCCACGAAGCGCTGCATCGACCCTTC
CTTCTCCTCTCCATGTACACTCAAAACCATCAAATCCGTAACCGGCACGCCACTAAAGTTGCCGTATGCGTTGTCGAGCAAATAAGCGGCGCGTTCACGG
AGCGCGCCGTTTCCAACACGGAATCCCCTGTTCACTGGGTGCTCCGTGACGCCCACCACCGCGTTCTCCTTCACGTATCCTCGCGGGTTCTTGGGGCCAT
GTACTCTTCGTCTCGCGGCTTAAAGATCCCCATCGGGTTCATCTTCCTGGCAGAAGACGTGGTCGATACCGTCGTCAGGTAGTACACACCGCCGCATCCG
TCGCTGGTGATCTGGAAGCTGCTGCCTACGTCCGCGACCATGCACTTCACCTGATCAGCAAAGCGTTCCGAGGCTTCGGTGGTGAGCCACTTGGCCCCCA
GAGCAGCAGGCAACTTCGTCTCCGACTCGCTCTTGTCCACATAGGTGCCTCGCTGTCGCGCTTGAAGGGTGACGTGCAGCGCAGCGGCGACAGGCGGGAC
TGCACGATCGGGTACAGTCTCGTGACCACGGTCTGCTGTAGCAGGCCCTTGGCGTTCAGCATGGCCGAGCCGTGCACCCGCAGGCGGCTGAAGCGACTCG
TGACCCGCTTGTTGTTGCTTGCCACCGTCGCTGTTTCATCCGCCTTGTCCGAGCTCGCGCGAAACCAGTCAGTGGCGCCCATGCTTCCTCTCTGCTTTTC
GGTCTCTTCTGGGCGGAAAAAGTCTCGGGGGCGGGGCTTTTTATCCGATCTGCTCGTAGGCGAGGAGGTCAGAAGAGAGGAAGGCAGAGAGGAGAGAAGG
AGCGTCTCTCTGGATGGAGGCTTGGAGAAGGCGGAGGGCGGAGCTTCAAGCGCTGCGCAGGGCGGAACGACGTGCGGACTTCAGTTCAATTTGCGGAATG
GCGACACCACGCTGGAAAATAGCCAGCCGCATTCTCTATATCATGGTTTGCAGGGACTGCATAAGTAAATGCATTCTAGATAAGAGGTATGCATTATAAA
GAGATTTTTTGTATAGAAACACTTGCAATAGTGAATGGATTTGTGCTATAGATAATGCAATTGGGAGGGAGCGAGGGACGGGCGGTGCAAACGCGTGCAT
TCAGCTTGCAGTTGTGGCAAGCAAGACAAGATCAAGCGTTGCTAACAGTTGCCGAGATTTCGCGAGCGGCGCACTGCGACAGAGTGTGATTATGCCTATA
AGAGACATACTGTGTGACGAAACGACTCGCCGTCCATCATGAACTTCATGGGCACGAGCGTCTTCCGCAGTGCGGAGACTTTAGTACGCGCTAGCAAGGC
CCCACATTGCTGCACGCTTGCCTTAAGCAGGACTTGACAAAATCAATATTAATAGTGTAGCTGCGAATAGTACATGTAGTATTGTGCTTTGCAGCTCTTT
GGACTCCAATTCGTACGCTTTGTCTTGCACGATACAACAATAAAGCGTACATGCTTTATACTCTCCCAGTATGTGCCTTGGTGATCTGAAAACCCTGCCA
CGACTTGTGGTTGCTTTGGCACTTTCTAGAAGTGTGCCTGAAACACAAAGTCTCTATGCTTTAGCGCTAAGTACGAGTACTAACTACTGCTGGACAAACT
GGTTGCAAAGCACAAAAAATATACTTCGAAGTAATACGTGTTCTGTGCTCATAGAAACTTTCTCAGCTCGGTGCTGTATCCAGTAGGCACAGATCTGCGT
GGACTTTGCCAGCTATTAATTGTGATTGCTACAGACTGTAGCCTTGCTGCTCTGCTACTTTCGTAGCAGACGCGCACTGGATATGGTCTTGCCACCTAGG
GCCGGCAGTACTGGCACCTTTCCCAACAGCTACTATAGTAATAGTACTGTCGAACAACGTTCTGTCAACTACCGAAATGGCTACCTTCTTACACGATCTC
CATAACTGTCGATAAAAGTTCTCCCGAGCGCGTTCGAAGAGCTCCGACCTAGGCAAATACGAGTTAGTGGAACGGCTCCAAACCCGACACACGAAACCAC
TGGCAAAGGGACCAGGACGCATTGCCAGCCCGTCAAACCATCAGCAGTCCTCCACTCCTCCTTCGACTAGCCGTCGGCAACATGACGCACAACAATGCAC
GGTATCGTGTATCACTCCCTCTGGAATATGTCTGCTTCGTCGTGAGGACGCCTCGAAGGCTGGACACGGTGGATAGAATCATCGCCAGTACACACACAGT
TGCGTGAAGACCTCAGCGCCATGGTCGCAGCGCTGGTATTCCAAGATCGTGAATGACACTCCACACGTTGTTACCATTGAGGCATTTGAGTGGGAAGCAG
TGATCTGCAAGCTGCAACTTGCAGTTCACGTGCGAGTAAGACGACGAGAATCACACAAACGCGAAAATGGGGTGGCATGTAAGCAGCAATTGCGCGGTCT
TGTTATCCATGGCGGTGGGGATCGGTGCTAGTTCAACAGTGCTATCGACGTGACAGGCTTTACAGTAACAGTAGAATGGAAATCGAGCAAAAGAATAGTA
CTACAGACAATCCTCTCGGTCGTGATATCCTGAGTAGTGATACCCTCCACGGAGAGATATGGGAGGGCTCCCGATGACCGTCACCATACAAGCACGAGTC
AAATATACCTCTACCCTCTAGTTACTGGTTTGTGATACAAAACACGTCATTATCACTATTCAAAGGTGCTTAACTATTGCTAAGGTCCATTTGGTGCAGG
ACGTCCGAAGAAGTCGAGCATCGACTTTTGCTGCTTGTGGCCTTGTCTACACGCAAGCTCCTCTCTAAATACTCGCTGCATCGTTCGAAGCCCGATAACG
TCCCTTGAACGGACCCCATCGCACCGGCGGTAACGAAAAGTTGTGCTATCCATTGAAGACGCTCCTTCAGCTCCTCTGTGGACAGGTTTCGGGCGTTGGA
TAGGTTGAAGAAGTGCTTTCTTCTTCTTCGTCCTCGATACCGCCATCACCGACATCTTGACCGCACCCATTCTCGCGCTCTGAAGACTCGACCCGGCAGA
AATCTTCGTCCGTTGGTTCATCCGCGAGGATGTTCTCGTCCGGTGGGTTCAGCAGCTCTTCAACCGACATCGGATTCGAGGGGTGGAGACGCGTCAGCAT
CTCTGCCAGCTCGTTCACGATGTCATCCTCACGCCCGGCTCGGCGTACTCGCACGTGTAGTAGTCAAGCAAGCCAGTCTTCTTCCAGCAGTTACTGAAGA
CGCTGGGAAGCAGGGCGTTCCAGCTCTCGATGCTCCACAGTACTGCCTGCTGTACGTCGACGCTGTAGAGCTGTTAAGTTCAAATGTACCAATTTTACGG
CACATTTCTGCCTTGTAATAACTCCAGCGAGTGATAATGTGGTGGTTCCCGACGCTATCACAAAGGAGAGGATTGTCTGTACATAACAGTAGTACTATTT
TGTGCTGGTGAGGCGAGTTACTGCCGATCCCTACATGTCACATTGTAATCTTGCGGGCTCCCAACGTGAGACCTAACACCGTAAGGCTTGCTGCATTCGG
CGAAAGCTGCCACCGACTAATCTGGCGTCTGTAGTCGTTACGCGGTATTATACATGTAGTGCCAGCAAACGCATCACTGTTGATGCTGGGGGGGGGTCTC
TTCCGAAATGGCAATATGCTGCATAGCCTGCTGCGACGCCGCGCGCTGGGATACCAGTGCTGTACCGGTTGGGGCTGCTGCCTTTGATTGACGATTCGGA
CCTGCAGCCGAGCAAATCGGCGCTGAAAATTGTAACGGGAAACCCCCGCTGCATGGTGCGCGTCCTCGGCAGTGTGAGTCGACACTACTATAATACACCA
ACATGCTGCCCCTGTACCACCGGAGGTGGCGCTGCACATTGCCATCGGCAGCTGGCCCTTTGCAGGCGTCAAGGCGCGCGATCCTGTCGCGCGGAGGCGC
CTGTTGGGGGCTCATTTGCAGCTGTTGTTCGCATCCTTGTCCTCGTCATATCCAGACTTGGCGCCAGAGAGAAGCCGCGGCGTGGCACGAAGTCAACCCG
GGCCCTCTTCAGCTATCAGCTGCTGCTGGCAGCGCACCATGCCGCGCAGTGCTCGACGTGTGCAACGCCCGAGGCGCATGGCTTTCTAGACCGCTGCCAC
CTCATGGGCGAACCGACAAGCTCAGTTGCTATTGTTGCTAGACTATGCCGTCGAGCGCTGTCAATGCCTCAATGCCTCATCCCCTGCCAGGTGTCAGCGA
TTAGCAACTACCGTCCGACACCGGTCTAAGTGCGAATGGGTTCGCTTCGACCCGGTGTGCATAGTATGGTCATCATATGGTGCCAACCGCTTCGATTGGC
CGAAATGCATGGTCATACAGCGTTTCTACTCGCTGAAATGTTTGCTAGGAGTTTTCGCCAATCAGACGTGCCCCACTACCCGCCCGCCTGGGATCACAAA
GCCCGCGGCCCATATTGCGCCGATACCGGTTCGTCCATCATGAGCATTGGCCTCCCTGCCTCGCGCTCTTAGCGCCATTCCGCGCTTTCCCGTGGCCTGC
ACAAGCGTCTTGTTGTATATTCCTATCTGTCCATAATGTCCATCCTCGATGTGTGTGCGTCCCCCATGCCCTTCGCGCTCCCCATGGAGTGCGCCTCCGA
GTCGCTCGAGGTCATCCAATGGGCGCTGCTCAAGGAGAAGCACTACCCGGCGCTGCGCAACCCGCGCTACCTCGCGGACGTGCAGCGTCACGGCATGACG
GCCACCTGGCGCCTGCGCGTGTGTCGCTGGATGTTCGAGACCGCCAAGGAATTCGAGCTGCAGCTGGACACGGTCTGCGGCGCGCTGCACTTCCTGGACC
AGTACCTGAGCGTGCACTCGGTGGACCGCGTGACGCTGCAGCTGCTGGGCATGATCTGCATGTGGACGGCCAGCAAGATGCACGAGGGTAAGCCCATCCT
GCTCGAGGAGATGGCGCTCATGTGCGAGCGCAAGTTCTCGCGCGCGCAAATGATCGACGCCGAGGCGCAGCTCGTGCGGCTCGTGGGCTTCCGCTTCAAC
CCCCCGAACGTCCTGACCATGGCGAGGGACTTCGTGAACGAGCTCCCGTTCGACGACGACCAGCGCGCCAACTGCGTCGCGTCCGTCTTCAACGTGCTCG
AGCGCGTGCTCGAAGACGTCTCGTCCCTCGACTGTTCCGCCTCCAGTCTGGCCAAGGCCGCGGTGCAGCTCGTGGCCAAGTCCGAGTACAACCTCACAGT
GGCACAAGTGCTCAAGGCTCTCAAGTCCATCAGTGTCGAGGAGGGTGCCTACCGCGCAGCCTTCAAAATTGTGCGCGGCGCCTACTTCGGTACGTCCCCC
GCCTCGACCAAGACCCAGATATCACAAGCTGTCGCTGTGGAGGCCATCAAGTCGCTCACGCAGAGCCCCACGGCCATCGAACAAGTCGCTGTTTTCGCCG
ACGACACGCCGTCGCCCCCCGACGTGGATGACTCGTGCCTCATCTGTACCGAGACGCTGTCTCCGTCCCCATCCCAGGCATCTCCTGCGCCCGTGCGAAC
GGCTGCATCGGCCTCATCAACCATCGGAGTCACTCGGTCTGCGCCCTCACCAACGTGCATCGAGTCCGATACCGAGCGACACAACAAACGTCAGCGCAAG
CTGGACATGTAGACACAATAGGAATCAACAAGACTGTAGAAAGGAAGGCGCTAACGGAGCCAAAAAAAACTAATTTATACTCTACGCCTACTTCCTAGTC
ACTGATCTCGATGCAGGTCACACTACCGTCGCTGTCTTCAGCATTTTCACCACGACGAGCGCTGCTGGCGTTATTTTGGTCGTCCTGCTCTTCTTGCTGC
GTGAGGAACAGCCTCCTGAGGTCTCCTGTAGACAGCCGCGTCTCACGTAACCGGTTCTTCTTGGCGGTGGAGAGGTCATCGCCATCGCCCAAGAATGCGG
CCGTAAGCTGGCGCTTCTTGTTCTGCAAAGCCACCACGCGCTCTTCAATGGAGCCTTTCACGATGAAGCGAACGACACGCACGTTCCTTGTTTGGCCAAA
TCGATGAGCACGATCGACAGCCTGCCGCTCAAGGCTGGGGTTCCAGCTAGGCTCCGTGATAAACACGTGCGCCGCAGCAGTCAAATTCAATCCGAGACCA
CCCGTGCGCAGGGACAATAGTAACACGTCCAGTGGTGGGCCAACGACCGGTCCAATGCCGAGGTTGTCTTCGTGCTGCTGGAAATTACGCACGACTTGCT
CCCGATCCTTGACTGACATCCTTCCATCCAGTTTAGCGAACGAGATGACCTCATTGCCCACCTCCGATGCATCTTCAAAGGATGAAACGCACTTCTCGCA
CCGAGAGTTGTGAGCCTCAAGGCGCTCCGCTATCACATCCAAGAAACTTGTCCACTGTGAAATCACCAGTACACGCTCACGACGTGCTCGCACCTTCTTC
AGCTCCTGCATTAATGCTGTTAGCTTCGTCGATTCCAATGGACCGCACCCAGACACAGCATTTCCATCAGCGCGGCGTTCTTGAAGCCGCTTCAACAATG
CTGCTTCTCCAGAGGAGAACGGAGAAATGCCGTCCCATCCGTTCCCTACCAGTGCTTCAGCACTTGCTGCCCGAGTCTGCACTTCAGCCAATGGGTCTTT
CGTTACAAGTGAAGTTGCATCACAGACCTGCCGCAGCCGCAGGATGAGCTCAAAGACGTGCATGAATAGCGGGCGCTCGTCCCCGTCGTTGGCTGGAGTT
GTGACGGGAACACGATGAGCTTGCTTCGACTCCTTGGATTGCAGATACCGCAGCACTTGCCTTTTAGTAGAGCGATGCAGTAGCATATACAAAGCGCGCT
CCACATCTGAAGCAAAGTCAAGCTCGATAAGCTCTTCAGTCTTCTCCGGTAAGTCCAAGATAGGAGCTCTTGAGCGTGCATCCACCGCGGATTTGAGTCG
GCGCATTACTACACGCGGCACCAATGCTCCAAGCTCACGTTCAGAAAGTGCGTGCGCACGGTTACCAAGCCCAGCAAACTGCAGTAGAGCTACAAGGTCT
GCCGTTCGGTTCTGGATGGGCGTGCCAGTCACACACCAACGGCGTCTACTGCTAAGAGTGAATGCAGCTCGCGCTCGTGCGCATCCAGCATTCGCGATAA
GGTGGCTTTCGTCAAGGATGACTCGGAACCACTGCAACTGATGCAGCTTCGAAGTTACCACCGGTCTCTTCGACTGTGGAGTAAGACGTGGCGCTTGATG
CCATCCATCTCCTGAAGCAGTACCATCGCCGTTGTCTTGTTCGCCATCTCCATCACTGTCCTTGTCTCGAATTTTGCATTCCAATAGGCGGAGAGTATCA
TAGGTCGAGAGCACGATATCTGCCCCCATAAACTGCGTTGCAGAGCGGAAGCTTTTGCGCGTGGCACCTTGATACGTCACCACACTCAAGTTGGTCTTGG
CTCGGATTTCGTGTTCCCACTGCGACAAGATGGAGAGTGGAGTCACAATAAGGGTAGGAGGAGTAAGCCGAGGCGCCGCGCCTGCTTCACTTCTTGCTTG
GGCATCGGCAGCGCGAGCTTGACGAAGAGATTCACATATAAGTGCGAGGCAGCATACCGTTTTGCCAAGTCCCATTTCATCTGCCAAGACTCCACCACAC
ACCTTCGCGACCAGAGCGTCAACTGCTGTTGCTTCACCACGGCGCTGTTGATCGATCGTAATAGGATCACTAGGATCTTCCTCTCGTCCCAGCATCCATT
GCAACGCTTCTTTCTGGTATGGTTGCAACTCAACCAGGAGCTCCGGCACAACGAAAGGGAACACGCCTGGTTTGGCGGCTAGAGACTTTCGACGCCTATG
GCGACGGCGTCGATCGCTTGCAAAGCGATATTCCATTTCCAGTGGAAGTTTTGTGTGCAACAATGCGCCTCGGTTGGCGCGCTTCCTTGATAATGCTGAC
CTGGACGAAGCTGTGGGAGGCGTTTGAGCTGCACGCCTTGCTGATGAAGCGGGAGGTGAAGCATGCGAAGCTTTTCTGGCTGATAAAGCGGTAGAAGATG
CAAATGTAGTACGTCTTGCTGAGGAAACCGTTGGTGAAGCGTATGTTCGTTTTCTCGCGGATGAAGCTAGTGGGGGTCGGGTACGACGTTCTTTTTGTTG
ACGAAGCTGTGGGGGATGCATGCGTTGACCGTCTTGACGAGTTTCCTGCAAGGTTCGTGTTTGGACAAGCCGGAGTGTTCGTTCTACTCGGTGTTTCAAA
GGGTTCTTGCTGCCTTCGAGTGCCTTGCGGAGTCGGCTCCCTAACGACCTGAAAGGCATCGGATGTATGAGGCAAACTTTCCACGGCGAGTTGCTCTGGT
TCAAGCATCTCTGTGTCCGGGTGATCATTTTCTTGTTGCTGTTCCACATCAACGTATTCATTTCCGTCTCCAAATTCGAAGTCAGGCTCCGAAGACCATG
GTGGCCTCTCAGTATTGTCCTTTGGCTGTGCTGAAGGTAATGATGAATGAATAGACTTTTCACCGGTGCCACTCATCTCGATAATTGGCTTTTCTTCCTC
AGCCATTTCAGCTTCAGGCTC