Description :
From Genome Similarity Track
Location :
scaffold_41:63432- 67121
Transcript NameFunction/comments
g1827.t1 hypothetical protein PHYSODRAFT_476815
g1828.t1 hypothetical protein PHYSODRAFT_470795

Sequence
3689 bases(100 bases per row)
TGACTTGAAGAAAGTATACTTCCATTTTGTGGTTCATTGGTGTGCAGCTAATTGAGGCATGGTTGATTCGGATGAGGCCTTGTCTGTGGCGTCTACGAGC
TGGCGCTATTGCCTACACATTGCCTACTACGGCACAGGCTTCGTGGGGTGGCAACGGCAACAGCAAGAGACGAAAAGCAGCTCGGGCCACGACAGCGTGC
AGGAAGTGGTGGAGGCCATCGTAACGGAGACGTTGGGGACTCCACAGCGAGTGAACGTCACCGGAGTCAGTCGCACGGATGCCGGCACCCACGCGCTCTA
TGTAATAACGAAAACAGGAATTGTCGGCGTTTTGGATTCAACTAACAGGTGCATCCGTTCTAGCAATACGGCTTCATCCGACTGGACAAGGAACTGCACA
TGTCCATGGACGAGCTGAAGGACCGAGTCAATGCGAAGTAAGTGGGGAAGAAGTTAGATGTGAACGGAGCTATTGGGTGACAGATACACTTGCTGTGACA
GACTGGGGAAACGGGTGGTGGTGCTTGGTGTGACTGTGCCGACTACGGGCCCGTCGCGCATCCGGTCGCGCTACAAGAAGTACATTTACTACTTGCAGCA
AGGACATCGACCGGATCTGGAGCTGGGCAAATACTCGTGGTTTTTAGGCAGAAGACTCGACATTCAGCGGATCCGTGACGCTCTCAAGTAAGTGAATAGA
GTGGTTGTTCTGGCTGTAGCAGAGGCTGACAGGTTGCGCGACAGGTTCTTGGAAGGCACACACGACTTCCGACCGTTCTCTCAAGGCCTATTGAAACAGA
AGTACGAGGAAATGAAGACAATTCGTACAGTAATTTCAGCTCAGGTGGTTGTTCGACGGTACGTCTCGCTTTGAGTTCCGAAAGGTATTGAACAACGTTC
TAACGTTGCGTACTACGTGGACGATAGCAATGTGAACTTCTCGCTGGATCCACAAGATTGTGGCAGTGGCGACGTTATCGACGCCGCAGACATGTACCGT
GAAGACGGCACCATCGAAAAGCACAACCCGGACGACAGCAAGGCTGTGGCTACAGGAGATCACAAGAAGCGGAAGGTCGACCAAGCGAAAGGAGGCGCGC
CAGTGCATTTTGTTTGCATCGAGCTGGTTGCCAACGGATTCCTTCGGCATATGGTACGACGGATCATTGGAACTCTGCGGCCCATTGCCGAAGGCACCCA
GCCGCCCTCCCGAATGCAGCAAGTTCTCGCTGGCGAGGTCCAACCTGGTCCGTCTGCGCCAACAAAAGCTCTCTGGTTGCATCGAACCTGGCTCACACAA
GAAGAGTACGACGCGGATTGCACTACGGACGAATAGACCACATTGGTATGAATAAGCTGGCAAACCCCTTACCAGGTTTTAGCTTTAGACGACCACTCTA
TAGCTCTTCGTGTTCTGCGCCTTCAGAGGCTTTTTCCTGCGCAGCAACATGCTCCAAGATCCGAGTAATATGCCCAAGGACGATCTCTCCAATGATTTCT
GGCGAATATTTCTCCACCATGTCTTTACGAGCTTGTTTGCCCTTGGCAATCGCTTCCTGCGAGGGAAAAATCCAAAAGATATAGTGAGAAAATTGCCCTC
AAATGGTAGGATTCGTAGAGTTCCTTTACCTCGGGGTGCTCCTTAATCCGAATCAAAAGCTCCTTCAAATGTTTAACGGAGGGATCAGCCCACAGGTGGC
CCCTGAAAGCGCCTTCTGTGATCTGTTCATACAGCAGAAATTCGTCAGTTCAACAACCACGTAACGACCGCCATCAATGCTTGCTTACCTCAATAAGTCC
GTCAATCTCGAGTGGGTATGAGTTCTCCTCGGTCATGTATTCCGTAGTACCGCTCCAAAACGTAGCGATCAAAGGACGCTCCATCGCCATTGCCTCAACA
TGAGGCCGCCCCCATCCTTCACCACGCGACGGAAGAACGAACGCATTGGAAGCTTTGTACAGTGACGGCATCGCCTCCTGCGGGATATGCGGCGGTAGTA
CGTGGATATGGGGCAGCTCATCCAATTTTTTGCCAACAGCTTCCAACGAAAACTTCTCAATGACGTTCATAAAGTCCTCAGCGGACGACGACGCTGTGTG
GTATCCGTTCGTAAGCAGTACTAACACAACATCGTCCTCCGCCTTGAAAGCCTCGAAGTACGCCTTTAGCAGTACTCTCCACGCCTTCCGCTCTTCCCAC
TTGAAGATAGATAAATACACTGTCGTCTTCTCGGTCATCTCAAATGTGGTCTCGCTTGCGAGATCGTACACCTTTTCCACCTTCTCCGGGTCGAAGAAGT
CCACGTCTACGACCTCAGGCACGACCTTCACTGCTGATCTCACCCCTCCATCGACGAAAATCTTCTCCTGGAACTTAGTGGGCACCCAGATCTCGTCCAT
CTTGTTCATCCTGTCAGGCCATCCCTTGGGCACTCGGTCCGTCTCGAACATGGTGCGTCCGACCTTGTACTGCGCTTTTTCCGGAGGACACCGCGACGTC
ATGTAGTGCGCAGGTGCCCAAGCGCCAGGTTCGGAATGGCAGATGGCCAGAGCGATCTTCCTGTGCTTCAACCGCCAGTAGAAATCCCTCTCCTCGATCC
AATGGTGCTCCAACTTGCTCTTCATGTCCGCAGGCAGGTCTCGAATGAACGACGGGTTCAATGAGTCTCCATGCTGCGTAATTAGCAGCTCAAAGGGCTT
CTCTAATGCTTTTGCATCTTGTTTAACCTCCGGATCTTCAGCGGTCGAGCCAGTACTGGCTGATACACTTGAATCCCCCAGTGCAGTGTCAACTGCCACG
ACGTACGAGTGCGCTTCACTGCAGTAACCCCCGCCGCTGAGGAAAGGGGCATACCAGAGCACAGCAGGAGGTGCTGGGTCATTGCTGACGATCGGACGCC
GCCCGAAACCTGCTGTGGGCTTCGCTAGCAACGCGCACAGAGGGAGGAAGAGCAGCAGCACTTTCATCGTCGATGTATTGACACAATTTTGACGATGTAA
CGTTAAATTCATGTTGGTCAAACATGATAATTGGATTTAGACTGATAATTGTTGTTTTGAGAGAAATTGTCCCTGTGTGGTTGCGTGAGGTGTGCATTGA
TCTACTTTGATATATCGAGTTTAGGACGCGTATTGCTTGGTCCAATCCTGTGCCGTCTTCTCGAAATCCGCCTTGTTCTCGTGCATTTGCTTGGCGATGT
CGGGCTCCAGCGGGTTGTCCATGTCCGGCTGCTCCAGGATCTGCTTGATAGCCGTCAGGCAGTGCAGCACATTCAACGTCGGCCCCCAATTCTCATTGAT
AATGTCGGCGCAGATTTCACCGGACTGTGACTTGACATTCGGGTGGTAGACCCGGGTGAGGAAGCGCACCTTGGGTGCCTTGAAAGGATATTCACTGGGG
AACTGTAGATCCAAGTTGAAGACTCCTCCAGCATACGGCGAGTCCTCCTATATCAATACCAGTCAATACCCGTTTACCGTTATTATTAAGCTCACAATTG
CACGTACGGGACCAGCGAGCATAGCGTTCCAATGCATGAGGTCGTCGTCCACGGCACTGACTGTGCACCATTCAGGCGAGTTCTTCTCAAACTCAGCGAG
CTCCTAATGACAGGACAGCAGCGTTAGCAGAAGTCCCGGAGGTAGCCGACAGATGCACTAACACGCACTTTAGTGAGACGGCGGGCCAT