Description :
From Genome Similarity Track
Location :
Scaffold_6:634301- 635656
Transcript NameFunction/comments
g1007.t1XP_008908728.1 hypothetical protein PPTG_13992 [Phytophthora parasitica INRA-310

Sequence
1355 bases(100 bases per row)
GCGACGAGCTTGTGGATCTGCAGCACGACATCTTCGGCGAAGGTGTTGCCGGCGTGGATGGCGAGAAGTGGCTCAAGCAGCGCCGCATCGCCAGCCACAT
GTTCTCCATGAAGATGCTGCGCGACGTCATGGACGAGGTCATCATCGAGAAGTCCAAGAAGCTGCGCGACGTGCTTGCTGCGTGTGCGAAGGAGGGCAGA
ATCGCCCCCATGAAGTCGCTGCTGGGCAAGTTCTCCAGCGACGTGTTCACCAAGATCGGCTTCGGCGTGGACCTGCACGGCTTGGACGGCGACATCAACT
CTGAAATGGACCACCCGTTCATTGAGGCCGTTGATGGCTACGCCGAGGTCTTTGGTGCACGCCTGCAGTCGCCGATGTGGTTCTGGAAGCTCAAGCGCTT
CCTCAACATTGGCGACGAGCGCATGTTGAAGCGCTGCATCAAGGTTGCAACGGATCTGCTGAACGACGTCATGCTCAAGTCCATGTCGAACAAGACCGCC
GAGGACTGGAACTCCAAGACAGACCTGCTGACGCTGTTCGTGGACTCGACCGGCAACACGGACTCCTCGGACTTGCGTGACGCCATGATGAACTTCTTCC
TGGCTGGCAAGGAGACGACGAGCTTCAGTATGGCGTGGATCATCGTGAACCTCAACCGCCACCCGCGCGTGCTGGCCAAGCTTCGCGCGCAGATCCGCGA
GAACCTGCCGGAGCTCCTGACGGGCGAGCTGGAAGTCCCCACGATGGAGGACCTGCAGAAGATCCCGTACGTCGAGGCCGTGCTCAAGGAGAGTCTGCGT
CTGAACATGACGGGCGTCCACCGCACGCCCATGCGCTCGACGACGCTGAGTGAAGGCACGTTCGTGCCGTTCGGCTCGTACGTGGTCATGTCGGTGTACG
CCGCCGCGCGCGTGAAGAACGTGTGGGGTGAGGACGCCGCCGAGTTCAACCCGGACCGTTGGATCGACGAGGAGACCGGCAAGGTCAAGTTCGTCAACCC
ATTCCAGTTCATCACCTTCGGCGGCGGCCCGCACCAGTGCTTGGGCATGCGCTTCGCCCTGCTGGAGATGCAGACCGTCATCGCCGTGCTGTTCAGCCGC
TTCGACATCAAGACGCTCGAGGACCCGTTCAAGATCACCTACGACTACAGCGTCACGCTCCCGGTCAAGGGCCCGCTCGAGTGCGCGATCAACGAGGTGG
CAGCCCCTGCATTCTAAGCGAGCTGCAAGCATAACTATGAATATTATCTTTCTTCACCATCGCCTGATGGCTCTTGTTGAAGCTGCTTACTGGTATCCAA
TACAACGAGATCAGCTGGGTCCCTCGCTCTCGAGATCACTCCACTCCTGAGCTAC