Description :
From Genome Similarity Track
Location :
Scaffold_2:634256- 643347
Transcript NameFunction/comments
g1495.t1XP_009532136.1 hypothetical protein PHYSODRAFT_347259 [Phytophthora sojae
g1496.t1XP_008902204.1 hypothetical protein PPTG_09098 [Phytophthora parasitica INRA-310

Sequence
9091 bases(100 bases per row)
AGGGGACATTGGAGCTCTGGAGGCAGCACACGCTCAAAGCGAGACAAGGGTAGAGATGATAGAATGCATTTGCTGCTTTGCTTGAGCAAGCACTTTACGG
TTGTGTTGTGTTGCTTGATTGCTAACGACTGACTGACTAGACGATGTCCATGATGAGCGCGACGCCCGCGAGAACCCAGCGAGCAGGTGGCGACTTGGAC
TTGAGCTGCGCCGAGAAGACGTAGGTGGGTCCACGGAACTCCGTCTTGTAGCACGGACAGACGTACGACCCCTTGATGTCGAGTTTGTCGGAAGCCACCG
CCTTGCAGTTGATGACGGGCATGGGGGAGAACATTTCCTTGGGGTGCGAGCGGTCCACCGTGTTGTTCTGCACGTCCCAGCGCGCACCCATGAGGTACAG
GCCGTGGATGTAGGCTCCGTCGCGCGATGGAGCGTCCACTTCGCCGTTGCGGCGCTTGAGCACGTCTGTCTGGATCACGAGCTTGTCGAGCTCCCACTGG
TTCTTCTGGGCCGTGACCTGCATGATTGCGGTCAGGAACGACTGCGGGTTGATCATGCCCGAGAGCCACGTGACGCGAGGGATGTCTGCCGGGTTTTGCG
TCCATTCCTCCAGTTGCAGCAGTCGTGCTTCGAGGTTCGTGAGCCATGAGCCAAGTGGGCGCATGGACGGGAAAGCGAGCTTCTCCCACGACTTCGGTAC
ACGATCCAGGAACAGCGACTCCTGCACGGCCTCCATGGCGTCCGACATGGTGAGTTCACCGGCAAACCCTAGCGACAATTCGTTCAGCGATCGGACAACC
TCGGCTAGCAACCCGTTCATGGCCTCGCACTCCTGGATAAACACGTTCTGGTACGGCCCCATCTCTTCGAGGTTGCGCGAGATCTCGTCGCACTCGAACT
TCTTCTCGCCGATGCGCGAGAGCACCATCTCTAGACCCTGCTTTGCCAGCTCGAGCGGACTCATGGTAGCGTCGCCTGCTGCGGCATCTCGTGGCTGCAG
CTCCATCAACGTCCGGAACAGGTTCTCGGACTGCGTCGTACGGAAATCGATTTCTGCATTCGGGTGCAGTCCGAAGGCCAGCGGCGAGTCCGTCTTGAGC
TCCGTCTCGATGTGCTCCAGGTACTTGTCATAGGACGAAGGTGCAAGACACATGAAGGACGGACCCTTTTCATCGCCGACAAAAGGGAACATCTCCATCT
CGTCCAGCAGCTCGTCGCGCATGTAGAAGTCCAGGTACGTGTTGGCTAGCAGCCGATCGAAGTCGTTCACAATATGCCCGCCGTACATGATCTCACCGAA
GATGTAGCGAAGATCGGCCCACGGGATCTTGCCGCCTGCTGAGCTTTCGAGGTAGTTCTGCAGACAGATAGCGGAGTCGCGCAGGTCGCCGAGCGAGAAG
GGGTACATCATGTTGAAGCCCAGAGGGCCGTACATCTTGCGCTCCATGAGCACGGCGTGGAAGTGGCAGAGGCCGAACAAAATGGATTTGACCTTGCCTT
CAGCCTCCTCGATGTACTCCTTGGCAAAGCTCACGAAGGCTCGCTTCAAGTTGGCCTTGAGACCGGACGGCGGCTCGTTTGTCAGCTTGATGCAGCGGTT
GAGCACGCCGATGGGGATGGAGTTGGACGGGTCCGACGTCAGGAACAAGCGGAAGTTCTTGTGCGAACCTTCCAGGGCGAACTCGTCTAGCTTCTTCTCG
AGCGCTAGCAACCAGCGTGGCATCAAGTGGATGTTGTTGAGGATGACCCAGTGGCCATTGCGGTGGGCAACCTCGAGGCGATCCATCGCGAACACATCCT
GTCCTTGGCCCATTGACACGTTGTGGTAGCTCACGCCTCGCTCGAAGCCGTACTTGATACTGAGTTTGTCCACGCCAGCCACCACATCGGCACCCGGAGA
CAGGATGAAGTACAGCGGTGTCGTTGGCGTCGAATCCAGGTACGAGTTGTCCATGACCTGCAACGTGTTGAGTGCCGAGTCGCAGTCGCAGTAGTTGCTT
CCGTTGGGCAGAACCTGCCGCACGAACTCGTTCACAGCCACCGTCATCCGATCCGGACGCAAACAGCGCACAACCAGAAGCTTCAGGAACGGCGTGCGAT
CGAGTCCGGCCCAATCCAGCGGCAGCTTCTCCGACTCGGGCGTCACGTGGTTGTACCATTCACGGAAGCGCGACGACGCCTCCTTGAGGTCCTGTGGCAT
CTTCTGGAACTCCTCGAGCTGCGCCAACATGTTGATGGCACTCCATTGAGCCGGTGGCAACCAGTCGATAGGGTTGGCTTCCTCTTCACCTCCACCTCCC
GCCGCTTTCTTGGGTCCGCGCAGCAGGAACTGCATGTACGCTTCTTGCACTCGCACGTCGTCGCCCAGGATGCCACGACGCATGAGGTTGAACGTGAGCT
GGGAGAGGAAAATGAGCTTGTGCGCTTCGAACAGGCCGCGAGCCACCCACGTGTAGATGGTGATCCGCAACGACTCACGCAAGTTGAGCACGCGCTCGCT
CTGCTTGTCGCTCTGCTGGGCTCGGTCGATCGAGTTGTAGAAGAACGTGATGAACGAGTCCAGGCTGTATCGGTACATGTGGTCGATGGCGCTGAGCGTC
GTGAGCAGGAAGTAGAGCATGGCGCCCTCCGCGGCAACAGGTCGGTACAGCTCGCGCGTGTTGTTGATGACAATCTCCGTCTCCTGGTTCTTCTTGACCG
AGATGGAGATGTCCGTCGCCTTCTTCTTCGTCTCCTCCAGACTCTCGATAAGGGGGACGTCGCTCAGGATATCGTCGGGGGCGTTGGCGAGACGCTCCAG
CAGTTGATCCTCGAGCTCCACGAGGTCGATCTTGAACTTCTGGAAGGCCAGCACCAGCTCCTGCTTTCGCGCTTCGAGCTCTGGCTGCTCCTTCTTGACC
ACCTTCTCCAGCAGTTGGTCCTCTAGACCACTCTCCGTGGCAATGAAGTTGATGAGCGTACACTGCGCCGCGATTTCAGGCTTGTAGTGCGGGTTCGACA
GCTTCGTCTGCAAGTACATGAAGAAGTTGGGGTCGTACTGCACTTCCTCGCCGGCCAGTTTCAAGAAGAGGTTGGACCCCTTCTTGTACACGGCTCGCCC
GAGCACCGGGTCCAGCGTGGCGTCAATCTCTTCCCCGATGTTCTCGATGATGAGGACGTGGCCATTCACGATAGCCGTCTCGGTCTTGCGCAGCCACTGG
TTCTGACTCAACTGCAGCACCACAAGGCCGCGGTCCTTCTCCTTCTCGCGGAGCCACTTGATGCCTTGTAGCTGCGGATCGATCACCAGCGGCCAGCGTT
TGCAGCTGGTGATGATGGCGCCGTTCTCAATCGAGATACGATCTGCAGGTAGGCCTTCGCTCATCATTTTGGCGTTCTTGCCCTCTGTCGTTAGCATCGA
CAGCGGATCGATGCCCTCCGTGATAGGGATCCCCTTGGCAACCAGGTCTGGGAACCAGGTCTGCTGCCACAGCTCCTTACGCACGGCCTGGTCGAAAGCG
CCGATGTACGACACGAAGGCGGCGGCCAGCAGCGAGTTGCCAACCACCATGACACCCGAGTTCTTGAGCTGCTCGATCTCAATCCCCCAACGCTCGTTTT
CACTCGCCAGGCCGTTCACGAGCTTGCCAGCTAGCAGCAACCGGTTCTCGCACGACTCCTTCATTTCCTCGACCTTGAGCTTCTCCTCCGTCGCTTGACG
CAGAGTGTTCTCGAGCGCTTCAAGCCGCTTCTGCACTTCCGCGACCTGGCCCATTGCGCGCGCAAGCTGCTCCTCCGCCTCCTCTTTCTTCTTCCTGGAA
GCCTCGAGCGAGTCCATGAGGGGCTTGACACGCACGTAGATGCGGTTGAACGTGTAGATGTTGACGACCCACGAGCAAATGTTGGCCGCAGCGGAGCTCT
TGGACGCCATTTTCTCGGCGGTGAACTCGGGGTCTGCGATCAGGGGCTCGATCCGAGCGATGTCTGCCTCGGGGATATCCTCGCCCTTGAAGTCCTTGAG
TGCGTCCAAGAAAGCACCAGCGTTGTTCATCATCTTCTTGGCGCGGTCCCATTTGTGGTTCTTGTACTCCTTCTCCACCAGGATGAGGCATGCCTTGGTG
ACATTCTCCACGCCTGCGGGCGGCTTGGGCAGACTCTTGAGCTCCGTGATAGCAGGCTTCGACAGGCAATCCACAGCCGCCGCAGCCGCATCCATCGCCG
GTTTGGCCTGCCTCAACTCCTTTTCGGCCTCGCCAGCCAGCTCTGCTGCCGCGGCACTAGCCGCTTCGGCCTTGAACTTTTCCTTGTTGGCATTCTCCTG
CTGCACCTCAGCGCCTGCCTTTTCGCGGCCCATTTGCTCGAGCAGCTGGTCGGTGGACGCCTGCTTCTCCGCGACCTTGACCATCGTGTGCTTCAGATCC
ACCTGCAGCTCGGCCACATCGGCCGACGTCTTGCGCAGCGTGGAGAGTCCATCGTCCAGGCGAGAGATTTGGCGCTGGATGTCCTCCTTCCGCTGCTTGA
GCAGGATCTCGTAGAAGCTGATGAGCTCCAGGAAGCTCTTGGGCGTCACGTAGTTGTACCTGCGCTGCGTCTCGAAGTAGTTCTTGCTCATGTCCGTCAC
GGAAATGTGCACGTCGGCCATGTGGTTCGCGAGGCTGCGCTGGAGTGGGGCGTCTCCGATGTCCTCGAACTTCTCCAGGAAGCTGGAAGCAACACGCACC
AGCGCATCGCGAGGCCACGGGTGGAACCAGTCGATGACGGTGCAGTTCACTAGACCCGGGAAACGACGAGCACGCACTCGGAACACGGCGCCCACCGGAG
AGAAGCACATGATCACGCGGAAGTTGAGTCGAATACGCAGCAACAAGAAGTCCATGAGTGCGTCCATCGCGTCGGGGACACCATTGGCCTTGGCTTCGCT
TCGCAGCGCACCCAGCAGCCCATCGAGATCCTCTTTCGGGAAGAGATCTGGGATCCAGCCGGACGAAAGCATGTCGTTGATGTACACGAGGAACCGCTCG
TTCACAATCTGCGAGTCGGTGATCAGGAACACGAGCGGCAAGCCCTGCACACCTGCGATCTTGAACATCTCGGCCAGATTCTCCTTCAGGTCCTCAATAC
GGAAGTTGGACGTGACCGACAGCTGACGTACATCAAAGCCGCAGATGTGCGACGCCAGACGCGACAGAGACTGCTTGCCGCTTCCGCCGACACCGATGAG
CATCGCGTTGCCTCCTGGGTTCCCGATGATGCGGCAGATGCGCGTCACGTGCTCCATGGCGTTGTCGAAGAGCTCCAAGTTCATCATGGAGTACTTGGAG
TTGTAGTCATCGAGCTGCTCGACCAGCACCTTGTTGAGTGCCTTCATGGAGGACACTGGCATGTACACGCTGTCCGCACCGGCCACTGCAGTTGCGAACG
TCGTGAAGATGTTCACAGGCACGGGGGCGTTGTCTTCGGAGCCTGGTGGCGGTGGGGGCTGGTCATTGAAAAGCGCCACCTGGTCCAAGTCCGGCAGCAG
CTTCTTGGTCACCTCGCGGATCCGGTCACCGAACTTGGCGATGTCCTCGTCGTTGATGAGGCGGTCGCAGAAGACTCGCGTGGATTCGTGCACCCACAGC
CGCGTGAACGAGTACCCCGTAGGGAAGAACTCGCCCTTGGAACGCGTGAGGCCCTGGAAAATATTCGACAACTCGCGCATGTTCCAGTTGTAGACGAACT
TGGTGGCACTCGGGAGGAACCTGTTGACCATTTCCTCGTGCAGCAGGATCGACACGTTGACAATGTGCTCGCACACGGTCATCACTTGCGAGGCAAAGCC
GGCATTCTGCATGTGGCCCCTCAAGATCGAGTTGTAAATGGTCTTGAGGTCCTCGCGGCCAGGCATCATGCATGCGAAGAGCGCGTAGTGCCGCTGCAGG
CGCTCGTCGATGATAAAGGAGCCCGCCGTGGGGTTCATAGCCGACAGGTACTGGACGTCCACGATCTCCTTCCGGAAGCCCAAGTCGATACGGTCGAAGA
AGGTCCTGTAGTCCATGTGCTGCCGCAGCAGAGCCAACGAGTTCTGAGTGCCGTACGTCTCAATGTACGGCAGGTTCAAGTCGTCGATGAAGTAGATGAG
CTTCTTCGTGGCCGGCGGGCCGAACATGCGACCCGAGCGCTTGTCAATGACCGACTCGAGCTGCTGCTGCAGCTTGGCCGAGTCCGTGTAGTAGTTCATG
TTGATAGTCGAGAAGAGCATGTCGTCGTCGAGCTCACGCAGGAAGTTCTTGAGGATTGTGGTCTTCCCCGTGCCGCTGCCTCCCACAAGCATCGCCGGCC
GCTGACGCGCCACGAGCGTCTCCACCAGGAAGCGAATCCGCACCGAGTCATTCGTGCTGATCACAATCGAGTTGAACGGCGTGTCGGCCGGACCATTGCC
GATGGAGCCGGGTGCGTACTTTGGCACCTTGGTGCTCCAGCTCTCGAACTCTCCTGACTCGAGGTTGTAGAAGTAGTCGAAGCACAGACCCTCCTTCGGG
TACTTGATGTTGGTGAACGTAGAGCACCAGAGCTCGTGGAAGTTCTTGCGGTAGTCAATACTCTTGTCAACGATGAGCGGCCCTCCGAAGGCCCACGTCG
CGCAGAAGACAAAGATCGACTCGATCACCTCCGGGTTCTTCTTCTCCGTTGGGATGTTGCCCAGAAGCCCCTCAAGCAGGTAGCAAATTGTCGACACCTG
GTTGATAAGACGCACCGGAGCCACCTGCTTGTAGCCCTTGCGCATCAGGTCGTAGATCGGGTCCACGTACTTGTCAAAGAGGCCTGGCAGATACGTCCGT
TCGACTTCTTCCTCGCGCTTCGCCACCCACGACTCCATGAATGGACGCCAGCCGATATCAATCTCATTGATGAACAGGATACCCGCTCGAGAGACCGTAG
CGGGCGTGGCATTCTTCAGCGAATTGATCTCGAAGACCATCCGCATGGCACTACTCAGCGGGATCCGCTCGTTCGACACGAGCGTAAGCACCTTGTTGTC
GTCCATGACCGTGTTCATGGACTCTATCCACACTGCGTCGATATCGCCGTCGAGCACCACCCACTTGTACGATTGGCTTTCGTAGAAGCCCTGCTCGGAG
TAGTTCTTGGCCATACCACGCATGATAATGGACAGCACGCCGTCTTTCCAGTCTTTCGAGAGCGTCATGTAACCATAGAGCTCGTCGGACGTCACGGCCT
TGGGGTTGAGCGTCTCGTACACGCAGATCTTCTTCTCCTTGCCGAGGTTCCAGCACTTGGCAAGAGCCTGCCACGTCGTCGTCTTTGCGCAGCCAGCAGG
GCCCAGCAGCATGACCGAGTGGCGCACATCGATAAGCTCCTGCAGCTGGCAGATCTTGAGGATGAAGGAGTCGTCAGGCTGCAGGTTGTTGGCTTTGCAC
ACGGCCACCGCCTTCTCTCTCAGCTCAACGTTGACCTTGGGGGCCACCTCAACGCCAATGAATAGATCGTTGATGAGCCGGAGGAAGATCGGCGTGTCGT
GGTGAGGGATCTTGGGCGTGTTGAAGTCACGCAGTGCACGCATGAGCACCTTATCCTCCTCGACGTCCGGCTCCGCACGCTTCAGAATGCCAGCGACACG
AAGCACCGACTTGACAGCACGGAGACCCCAGTCGTAGTGGAACTGCTTGGAGAGCAGCTCGCCACTGAGCTCGTACAGCGTCACGAACTTGATGGCCAGA
GTGCGTGCCTGCTGGAATCCTTCGGACATGAGCATGTTCTCGCAGATGGGCTTCAAGTCGGGTCGGATCATAGCGCACGATCGGAAGAGCACCTTGAGGT
TTTCAGGCAGCTCCGTTCGCCCAGCGTAGCCAGGGTTCATCGTGATGAAGAAGCCGCACGTCGGAATGAGCGTGATCCGGTCCGAGGCTCCCATGAACTC
AAACTCGCCCACGACCACGGGCGGCGTGCCGGCCGGCAGCGTCTGGTACTTTGCCTCTCGGTTGGCGGGGATAGCATTAAACACGATAGCGTCCTGGATG
CACTTGACCTGGGTAGCCACCACACTGAGCACTTCGATGTTGATGCGGTTGAACTCGTCGAAGCAGCCCCAAGTGCCAGTCTGGCACAGGCCGCGGAAGA
TGTCTGCCATGGTCTGGTAGTTCATCTGGTCCGAGCAGTTGAACACGTAGCAGCACAAGGCCATGGCACGCGCCAAATCTTTCGTCGTCTCGGTTTTGCC
AGTACCCGCAGGCCCAGCAGGAGCGCCGCCCAAGAACAGCCTCAGCGCCATGGTCAGCGTGATGTAGCATCGATCTGTTAGAGGCGTGATCACAAGACGA
CCGGTGTTGCCAATCCATTCGTACGAGTACTTGGACCGGAAGTCGGTAATTCGGATGTCCACGTCGTAGTTCTCCTGGCGCCAGATGAAGCGGAGCTGCT
GCTGCCACATGAAACTGAGCGGGCCTTCCACCTTCTCGTCGACCAGCTTTTTCACCACGTCGCGCGAGTGCACGTCAAGTGTAATGAGGGCGATGATTTT
GCAGCGATCGGGGCTAGAAAGGTTGCCTAGCACGAGGTTAATCAACTGCTCCAGGCGCTGGTTGCACACGGTCAGGTATCTCTTGACCGAGTCTTCCTGG
CCGTTCTCAAACTCTTCCAGAGCCATCTCCGTCTCCTCGGTCCAGTAAATCTGCGTCGAGTTGAGCACAACTTGGGCTGGGTAGTCAAACAGCCACTGGT
GGCGAGGCTTCTCCACGTCCCAGTTGGCCGCCGTCTCGATCGAGTCGTGCATCTCCTTGCGGAGACAGAACCTCATGGCCTCCGTCAGCTCGTTCAGCCA
GCTCTCGACTGCGCCCGCCATGACGAATATCGTGGGCAGTCGGACGGACTCGCCGTCCTTGGCCACCATCGTGTGCGCCGTGTTCGGCGAGTCGTCCTCA
AAGACGAGGTCGCACAAGGAGTCGTAGCAGTCTCCGAGAAACGGCATGATCTTCTTCGGGTTGTTGCCGTTCGACAGGATCTCCAGCAGCGCCACGTTCG
ACACGAAGTAGAACCGAGGGAAGATCTTCTTCTTCTTGTCCAGGTACTCGTTCAGCGACTTCTGGCACTTCTCCAGCATCGCAGTCATCTC