Description :
From Genome Similarity Track
Location :
Scaffold_1:634167- 637063
Transcript NameFunction/comments
Hyaar_Emoy2800139Mitochondrial nuclease putative
Hyaar_Emoy2800140hypothetical protein
Hyaar_Emoy2800141PREDICTED: 2-phosphoglycerate kinase-like

Sequence
2896 bases(100 bases per row)
GCAGACGGACAGTAGCAGGTGTGTCACTCGGCATTTCCATTGGCGTCGCAGGGACGTTGATCGTGCTTGGAATCGAAGAGGAAGAAGGCAGGAAAAGAAG
ACCTTTTGCTCTACCAGCGGACTACAATCCATCGAAGCCCAAGGCGCTGGTTGAACACGAAGCTCTGCGCTATGGAATGCCGTCCAACTCGAATGTTTTC
GTGCGGTCCGGCTACGTCGTGTCGTTTGATTACCGGTACTGTTCACGATGCAAGAACAAAGAGAACGATCTGATAGTAGTAGGAATAGTAACAGCCAATG
TCCTTTGTGCTCTTAGTGACTACAGCTGCTACTGTCATTGCTGCGTGCTTTGACAGGACGCGCAATCCGTCGTGGGTGATGCAGTATTTGACAAAGAACT
CGCTGCAAGTGGAGCACGAGACTGACCGAGCGAACTCCAAGTTCATGGTGGATAACGATGTCCCTGTGCAGTTTCAAGTGCATCCAAATCGATACACTAA
GAGTGGCTACGACAAAGGGCATCTCGCGCCAGCTCGTATGTTGTTGGTATTTTCACGATGAAAGGGTGTGTTTGTTGTCAACGCGCGCGTGCTGACTGCG
CTGCGTTGTGTGTAGGTGATATGAGCCATTCGCAGCAAGCCATGGACGAGAGTTTCTTGATGACGAACATGTCGCCGCAGGTCGGTGTGGGCTTCAACCG
CGGGTACTGGGCACGCCTTGAAGGGTTTGTCCGGCACCTGGCTGGTCAGTATGACGCCGTTTATGTCATTACAGGACCTCTGTTTCTACCCAAGGTGATG
CATAATGCTCACTTGGCGCGTGTTTGTAATTGTTGCTGATGCGCCTCGTGTCTTGGCCATCCAGAAAAACAAACGAACTGGAGAACATGAGGTTTCGTAC
CCTGTGCTAGGTGCTCCGCCGAATGCTACGGCTGTGCCCACACACTTTTTCAAAGTGGTGCTGGGTGAGCACCGAGGCAAGCGAGCATTTGCCGCAGCAG
GCTTTGTTCTGCCAAACAAGGTCATCCCCGAGAACAAGGACCTTCTCGACTTTCAGGCTCCTCTTGATGTTATCGAGAAGCAGGCTGGTCTGCTTTTTTT
CGACAAGGTATGCGTAAATTCTAGGTGGCTTTGTGAGCACTGGTACTCATGCAGACTTTGATGCTGCCGCAGCTTGACGGTGTTGAGAAGATGGATCTGT
GCAGGGTGAGCAAGTGCGGAATAGTTGCCGCTTACCGCAAGACCTCTGCTGTTAAATCACACCGACAACAACTGTGATTGTACAAACCAGAATGTTTCCA
ATCGAAGTGACTTGGTTCGCTTTACTACGAGAAAGCATTCATCATGATGACTTCTATGAACAGTTTTGTCGTTTTCACAGGCCGACCACGGGGACATTTG
CACAATCCGGCGAGGTGGACGGATTGGTAGCACCACAAATTGCCCCTCGAAATAGATACACACATGCATCACACAATCGTTCTGTATTGTCAATACATGA
GTCGAATCGTTGACGGCACTATACTTGTCGTGAAAATGCTTGTAGTAGGGACACCCAATCTTCCGGACTTAAATAACGTGAACGCTGCAGCGAAGCGAAG
ATTCAATACACCGGTGCAGGATGCCCATCAACCCCCTCGCTGCGTGCCCGATTTCTCCATCATCTGTTGACGACGCATCATGTCAAACTTACCTCAAGCT
TTGTCGCGGGTTGCAACAGCATCTTTCAGCTCACTATAGTGCTGAGAGTATTCTGACGAATCGGTGAGCTCATCCCAAGTCCATACACGCTATCCTCGTT
GCAGTATTATCAAGTGCATCTGCATTCGATACGAAGAAGGGAGCCGGCGTCCTGACGCGTATTGCATTTGCATCAGATAAGCCAAAATTCGTGGCGCGAC
ATCACGTAGCATATTTCTTCCGGGGGCTGCCCACTAGCTGCTTCGGCTTTGCCCCGCAACTTTCAACTTTGTAAACGATGAAGGTGTTCGCTGTTCTGCA
ATGAACTGCGAGCCACCATAAAGTCTGCCTTACTCATGGTCTTCTCTCCCTCTGTACAAAATATTTAGCAACGCAACTCAGACTAATCCACGCACTCGCC
TTCTGGTGTCAAAGATGTTAGCATCTCTTGAATTCGACTGAAGCGTGTGACCGACGCTTGCCTTCTCCGACTCGATTTCCTGTGAACGACGCACCAACAC
AAGACCTCAGGTGCGCGGTTTTGCCTTTGCGGCTCACTTCCTTCTTTTTTAATGCTTGTCTTCTTCATGTTTACTCTATTACGGTACTCGATCTTCACCA
CATGATTGTTCTTCTCACTTTTCGAGCTTGTCGCAATTGATCTACATGCTCCTCGCTTCCTTCATTCCCAGAGCTTTCAAAAGTTGCTCGTCTGCTCCAT
CTATGCTTCCTCACTGTATACAGAGCACGATTCTTGTCCTCATTGCAAATATCTTTCATCACCCTAGCTGTCAGAAGTATCAAAAGAAATTTCTTTGACT
GTCAGAATCGTTAAAAGAACTTTACCCTGACTGTCAGAATTGTCAAAAAACCGTGTCTTGGTTTGGCAAAGCTTGTCATTGTTTTCTGCACATACTCGTT
ATCGATTGGTAGTAATCATGCTATCACAATCACACCAATATTAGCGAATCATCGCTTGAAACCACACCCTCCCCCTATTGAAGTGTCGATACAGTAGCGC
TGTTGTCGTCATGAGCCTAAATGAACACGACGTGGTCTTGCCAGGACTCATGGACATGGAGGAGACGCCACCACCTACGAGGCCACCACCAGTATCCAAG
GCATTGAATTCACAGCAGACTGAGGTCGTGGCAAAGCGAAACCAGTCCAAGTATGATTTTGTGAAAGTGCGCGTGTGGGTGGAGGACCACGTTTAC