Description :
From Genome Similarity Track
Location :
Scaffold_21:63414- 64905
Transcript NameFunction/comments
Albla_Nc140252506phosphogluconate dehydrogenase putative
Albla_Nc14025260conserved hypothetical protein

Sequence
1491 bases(100 bases per row)
ACCCATCTCCGCCCATATCATCTTTTTTGGTAAATATTTTGGCAGTAATTTCGATCAGAAATGACTCTAATTCGCTTTTGTTCCAGTCCGCAAAGACCTG
AGCCAATTCGGAATTACTGAGTCCGCCAGCAATCTTCAAAATGTCATACGTCTCGGCAATCAGCTGCATGTCACCATACTCGATTCCATTGTGAACCATC
TTCACATAGTTCCCACTTCCAACCTCACCCAAGTACGTGGTACAAGCTCCATCATCGACTTGAGCCGCACACTTTACCAGAATTGGTTCCAATGCATCGA
AAGCTTCTCGTGGTCCACCAGGCATTAAAGATGGACCATTACGTGCCCCTTCCTCCCCTCCAGAGATTCCCATGCCAACAAACATGATCCCTCGAGTTTT
CAGCTCTTCAGCTCGGCGGATGCTGTTGGGGAACCATTCATTCCCACCATCGACAATGATATCGCCTGCTTCCATATGCTCTGCGATGATGGAAATGGTC
ATATCAACAGGTTTTCCAGCCATCACGAGGATAATGACTTTGCGGGGAACAGAGAGCGAGCGAACAAATTCTCCAACGTCTTTAAAGCCCACGAGAGGAA
GATCTCCCTCTTGTTTGGCGCGTTCGACTGTAGTGTCCACTTTATCGGGTGAGCGATTGCAGACAGAGACACTGAATCCGTGGGAGGCCATATTCAATGC
GAAATTCTGACCCATCACAGCCAATCCATACAGCCCGACATCGGATAACTCGACCATCTTTGGCTTTTCGATAAATGAGCAATGTCGGGGGAAGAACGCG
GTAGTACCGTATACTTCTTTATTTACGTACCTTCGAAAAACCCTGGAAGGTCTCTCCATCCAAACGATTGGGTAATATACCCCTCATCACTGCCAATCAA
TAAAAAGTGCTCTTTAATGCATTTCCAAATCACGGAATCGCACGCTCAAGTCGCAGCCTCGTTACGCGTCAACTAGGACATGTACAGCATCACTTTCACA
CCAAACATAATCAATTACATCACATCTAAAACCCCTGCAACGGATACATCACAACATGCTCTCTGAAAGCGCGTAATTTGCTTATAAAAATACCCTCATC
TAACGAGTCAAAGTTCCTTCCCACCTCCACAGCCAAGTTCTCTCTCCTCATCCAAAGACATCGTCCGACACCCATCAAACACGTCGCTATACGCTCCCCA
TTCGCTCCGATTCCCGCCACGAATTCGAATGGTATACTGAGTACCCGCCTGAAGATTTGAGATTTGATGCTTGAGCGTATCTGCCGGTACAATGTCTCTC
ACTGTGCGCCACAACGCTGTCAATCGATTCTTTGCATACTGAATCTGATACATTGTGATTCCCACATCGCTAATGGGCTCCCACGTGACAATCAGGCTGG
TAGAAGAGACTGCGAAGACTTGGAGAATTCGCGGTGGAGCCAGTTTGCCCGGTTTCTCAGAGTCGGAATGATCGTTACATTCGTCACAATC