Description :
From Genome Similarity Track
Location :
contig_25:63406- 65280
Transcript NameFunction/comments
g4891.t1hypothetical protein

Sequence
1874 bases(100 bases per row)
TCCATCTTCTTGCTCCTCTCTCCACCTATTAAAATCGTTTGCCAAATATGTGCTGACCCCGTCCTCAAGTCAACCCGTTCGGTGTCTCCTTCCGTCCCGT
ACATCTTACTCTTACCAGTATCCATAGCCTTGTTGGCCAAGGCATTCGCCATTTTGTTGTGAGTTCTGTAATGGTGTGTCCAAGACTCCACCTCACATCG
ATCAGCTAGCTTCATGGTTATCTTGTACCAGTACTGCATCTTCCTCGTTTCGGCTTCGTCCGCTCCTTCATCATTTTCAGCTATCTCCGACCACGTGTAT
TCCATTCCACTCCATTTTGACTGCCCTTGCCAAAAGTCTATGCAGCCCCGTAAATTCAGCTACGTTGTTGGTGGTAGCTCGACTACCAAGCGCTGTCGCC
GCCGCCCACAACACTACAGGTAATACCTCGGCGCCCTTGTCCTCGACGATGATACTCCCACTGCCTCCCGCACCTGGGTTACCACGGGAGCCGCCGTCAA
AGAACCCAACCCAAAGCACATCGTTCCTCTTCTCCGGCACTGCGACGAAATCCTTTCTCCTCCAGTGCCGAAGGATTTCTCCTGCAGCCTGTATCTTGGT
ATATGAAGCGGTAGTCATTGGGTACAGTCCCAAACGAAAACGCTCAAAGGCTTCCACTACACTTGTCTGGTATCGTCTGAGTTGGTCCGCAATCGCTGCA
GCTTTTTTCCTTCTGGGTGAAGTCGATCCACATTCCATCGCCACAAAGCGGTCAACGTAACCGCGCAACCGAAAGCCCACATGGAGCAAGCACTTCGGTG
ACTTGATCCCATGGCTCCACCTCCTGCTCGACACCCCATGTAGTTAACCACCCCGGCATCTTCTGCAACTTGAACCCGAACATTTTCATGATCGCCTCCT
CTTGTGTGTCTTTGATTTCCCATCTCATGCACTTTGCACCCTCCCATTTTGCACAGTAGAACCTCAGTGATCTTGCGCCTCCTCGCAGTCCCATGCCAAA
TGTGCCGATCCCAATGTCTTGCTGTTGGTGCATCCAGCAGCAAGGCACTTGAAATTATTTTCTTTGCCGGCCCACAGACGAAGCCTGTTGTTCTTTAACC
GTACCACCGTATGAGCTTGATAGGCGGTGACGCCTTCCATCCTGTGAATCCTCTTCCATTTCAACTACTCTAGGGCCCGGCCATGCTAGCGTGATTCGCC
TTCCACGCCTCCCCAATCTGAGCTTCGGCCTTGATCGCTGCTGCCTCTCTCCGTTTACCAATGAACTTCTTGTAGGACTACCTACTCTGCTTCCATCTCC
GCTTTCCAGCCCAAAGCGGCCTCATCCGAGTCAGCCATGGGTGGGGCAGCACCCAGACGGACGATGTCTCCGCCTCCAAATAGTTGGGACTCACCCTTTG
TATCTATGGTAAGGCCACTTAAGCTTGAGAAAGTGAATTGCATTCTGGTCGGCTATGGGGACCTACCAGCTCGCTGCCTGCTTCCGTGCTGCTCCTTGTC
CTCGTGGCGCTGTCGCCCAGTCACATGAGCAAGAAGCGCCTTCGCATTCACCACACGTCCTTGCTTCAGTATCACCTTGTCCTTGTAGCGCCTCCCATCG
TTTCTTCGCAGCACTGCATCTCCTACAGCGTCCTTCATCACTTCTTGGCGCACCGCATCTCCTGGGACATCAGCGTCTCGTTGTTGTTGTTGCTGCTTTC
TGCTATCAGCTTTGAGAGGTATGCTCCACAGCATCTGACGACGACGAGACAGAGGTAGCGACCCCTGCCTCACCGGCTTCATATCTTCCCCGGTCTCTCC
TGTCTACAGCGCCTTAAGTACCGGTATTGTCAACGAGCAACCGCTTGGCCGCGGTAAGCGAAGCCGAGCCAGAG