Description :
From Genome Similarity Track
Location :
contig_27:633950- 635730
Transcript NameFunction/comments
g6013.t1hypothetical protein

Sequence
1780 bases(100 bases per row)
ATACTGTTCTACTCCGCGACTGTAGTGTGGCTGGTGCTTCTGCGTCAGATTGTGGTCTTCTGTCGGTTCTTGACACATTTGAAGCTGCAGGCAGACAGCT
CGAATGATTCGGCGCACACATCTTCACTTGGCAACTACTTCAACAAGCTGTCGCTTCCAACGATAAATGAGCGAGCACGGCTTGTGAAAGCGTTCAAGAA
GCTCCTGTATCGTGCGGTCGCTCGTGGGGACGTTCTTACTGTGGAAACGCTCCTGTCCGAGTCCCAGTCAAAGTACAAGATTGACCATATTCAGGACTTG
TACAGGCCGCCAGTGCTGTGGTTTTACGCTTTCGCGAAATCGAGAAAGAATCCGCTTCATATTGCCGTCAAGCGAGGCAATATGAGGATCGTGCAGATGC
TGCTGGATAGTGGAATTGATGTGAACGTACTCGACAAAGTAGTGCGGTGAACTTCAATGTTGGTCTTGTGTTTAAGATCTTCAGTCGCATCCTGGTAAGC
TGCGAGTGCTATTTGCTGTATGTGCAATTGTACACGACTAATATTTTTTGTGCTTGCACTTGCGTAGGTTCGAACGAAGACGGAGTTCGATCACCCCTCA
AGACGCTCCTATGCTCCGTTCTCCTTCCTCCACTTCACGGTGCAGTAGCCGAAGGCTACGTTGATATTGTCCGTTTACTTATCAGCAAAGGTGCTGACGT
GAATGCTCTCCCGCGCGCTTCGTTTTACTACCCGGCAGCCGTTCTTCCACCTATATTCGTGGCGGACGACCCGCAGGTGCTGCGCTTGCTGGTAGCAAAT
GGCGCCAACTTCCTTCAGGTTGCATCGGTATCGCTGACTGGTTTGATCCGCACGTACGCAACGCCGCTGCAGCAGAGTACGTTTACATTGAGATCGGATC
TGAGCGATTACTTGCTGGACTGCGGTGGTGACGTTGCACTGACACCACTTCACGAGGCAGCAGCCACTGATAACGTCGGAAAAATTAAGTGGCTGCTCGC
GCGTGGCATTCACGTGGATACGCTGGGAGAACGCGTTGAAGGTGTGCACCGTCGGACGCCGTTACACTGGGCGGCAGTTGTTGGAAAGGTAAACGCCGCC
AAACTCTTGCTGGAAAAGGGTGCAAACCCCAACGCAAAGGACCGCGATGGCCGCACGCCCTTGCATTGGGCAGCCAGAAACAATCACGATGAGGTAGTCT
CCTTACTGCTCGCTCACAAGGCTGAGCCTGATGCGGTTGATGGTGAGGGCATACCAGTCGTGTGTTTTGCGGCGGAAGCTGAAGGTGTCGATTCGACCAT
TTTCTCTAACCTGGTGGCTGCTGGCGCGAGTCTGCGAACCCAAGTGTCAGGCGGAAACACTGCGCTGCACATCGCTCTGCAGCGTGAGAACCGGCAAACA
GCAGTATCGCTGATCAAGTGTGGATCAAGTATGATGATCACGAATGATTCGGGCAAGCGCGCTGTGGACTGCACGACGTCTACTGAGCTGCAGTTCTTGC
TTAAGAAAGAAGCAGGAACCCGCAAGATCATGATCTCGTACACTCACACACATGCACAATTAGCGCAAAAAGTTCGCGAACATTTGGAAACACAAGAGCA
GCTCACGTGCTGGATGGATACCATGGATCCTAGCGGAATTGGCGGTGGCGCGGTTTGGCGAGAGGAGATTGCGCGCGGTATCAACAACTGCTCGCTAGTC
CTGAGCATTGTGTGCGACGGCTACACCAAGTCTGAGTGGTGTCTCAAGGAGCTTGCGCTAGCAAAGCTGCTCCGCAAACC