Description :
From Genome Similarity Track
Location :
Scaffold_121:63388- 64539
Sequence
1151 bases(100 bases per row)
TGATAGAATTCAAGGACGTGTTCCCTGAATCCGTACCATGCGAATTTTCTAAGGATTAAGGCACTCGACATGAAATCGAGCTCAAACCGGGTTCGAAGTA
CTGTGTCATGAAGCAGTGGCAACTGCCTCGTGAACAAGTACTTGAGATCGACAAGTTCTTTGCCAATCGCTTAGCTGCGGGTCATGTGAATGAGTCAACT
TCCCCTCACAGCTCTCCAGCCTTCTATGTGCGCAAGGCTACTGGAGGATGGCGGATAGTGCACGCATTCAACAAGTTAAATGCTGCAACGGTACCGGCTC
AGACGCCGATACCAAGGAAGGATGTCATTACAGATAGTATGGCTAAGAGTACCATCTTTTCATCCATGGATCTCATGGATGGGTTCTATCAGATCCTAAT
GTGTGAACGAGACATCCCGTACACGGCAGTAAGCACCCCGAGCGGTATTCTCTGGGAGTGGTTAGTAATGCCACAAGGGCTTAGCAAAGCCCCTGCCATA
TTCAACAGATGTGTAACGAATCTGTTAAGATCCGTAAGAGGTTTCGCGCCCAGTTACTTCGATGATGTGTTCGTCCATAGCCGGGCTATGGATGGACAGA
CGGATGTGGAAGTGCACCGACTCCACGTCCGGAAAGTTCTTACAATGATGCGCAAGCATAAGCTGTATGCTAACCTCAAGAAGTGTATATTCGCTGCTAG
CGAAATACTACTTCTTGAGTGCATCGTGGGTAAACACGGCGTACGCCCTGATCCGGAAAAGATCAAGGCGATCACCGACTGGTCTGTGCCAGTTTCGAAG
TTAATAGACTAAGAAAGTTTTTTGGTCTGGCGGCGTACTTACACAAGTACTCGCAGAACTACGCTGAGATGACTGTTCATCTCTCTCGTCTCTTATAAAA
GAACGAGAAATTTTCATGGAACGCTGATTGTCAGTGTTCCTTTGAATGTATCAAGCAGAGCTTGATGAAATCTACCATCTTGTTTATTGCAGACCAAGAC
AGATCATTCCATGTGGTCTGTGACGCCAGTGATTTTGCAATCGGCTGCGTGTTAATGCAGTACGATACAGACGGCGCAGAGCGCGTCGTCTGTTATCAAT
CGCGTCAGCTGCAAGCAGCTAAGAGTAATTATACAGTGCATGACAAGGAAC