Description :
From Genome Similarity Track
Location :
Scaffold_7:63362- 65019
Transcript NameFunction/comments
Physo_519361myosin-like protein

Sequence
1657 bases(100 bases per row)
CAGATCGACGCCAACCACCTGCAGGTCGGCACCAAAGTGTGGGTGGCCGACGCCAAAGTGCTCTGGCGGATCGGCGAGGTGCAGAGCATCGCCGACGACC
GCAAGACGGCGCAGGTCTACCTCCCTGATGCTGCAGACGACCAGGTGCAGACCCTGCGCATGGACCAGCTCGTCACCTTCGACGCGTCGCACATTGTGGA
TCACGCGGACGTGGCGCTTATGAACAACATGCACGAGGCGCCGCTGCTCAACGTGCTGCGCCAGCGCTTCGAGCGCGACGAGATTTATACCTTCACGGCG
GATATCCTGCTGTCCATCAACCCGTACAAGTCCATCCCGCTGCTCTACGACGTCGTGGGCTTTATGAAGAGCCGCGAAGAAGCTGCCACCGCCACGGGGG
ACGGTTCTACCAGCGACAGCAGCGCACCACCTCACTTGTTCTCCATCGCTGAGAAGGCCTACACAGGCATGAAGGGCGTCGTTCCTGGGTCTGGAACCCC
GCAGTCGATTGTCATCAGTGGAGAGAGCGGCGCCGGTAAGACCGAAGCCTCCAAGTACATCATGAAGTACCTCGCCACTGCGAGCAAACACGCCGCCAGC
TCTAGTACAGTCGCTGCAGGCGTCCACGAACAGATCGAGGAGTGCGTGGTGCTCTCCAACTTGATCCTCGAGTCGTTCGGCAACGCCAAGACGTCGCGCA
ACGACAACTCGAGCCGCTTCGGCAAGTACATCCAGATCCACTACAGCAGCGAAGGGCGCATGGCGGGCGTGTCCATCCGCCACTTTTTGCTGGAGAAGAC
GCGGCTCGTGCGACCGGAAGTGAACGAGCGCAACTACCACATCTTCTACCAGTTGCTGGCGGGTCTCGACACTCTGACAACCTCGTCGTCGGACCCTTCG
GACTCGGATCGACCCTTGTTGCTGCAGAATGACGTGTGGAACTACACGTATCTGACGCGTGGAGACTGCGTCGAGGTGGACGGAGTGGACGATGCCACCG
AGTTCGAGCAGCTTCGTCGGTGTCTCGAGCAGCTCGGAATGGACAACGCCAGCTTCCAACGCCCTATGTTTGAAGTGCTTGCAGCCATCTTGCACCTCGG
TAACGTGCAGTTTGAGAGCCCCACAACGCAGGACGACACAAATGGAGACGATAGTCGCGAGAACGACCCAACACATGTCGTGTTCCCAGAGAGCGACGCT
GGAGTGAACTTGGAGCACGTTGCGATGCTGTTGGGTGTCGATGCCGCCGAGTTCGCGAACAAAATGGTGACGCAGACCACCGTAACTGGTCGTGGCAGTA
TCCTCGAGATCAAGCTCACACCGGAACAGGCCAAGAATGCCATGGACGCCTTCTGCAAGTACCTGTACGGCGAGCTCTTCCACCACGTGATCACACGCAT
CAACGCCTGCGCCAAGCAGCAGACGTCTCTGATCCCCACAACGGACAAAAAGACGCCAAAGTCTCGTGTCCAAGGCGGTGCAACAGCGCCCACGGTAGCT
CCATTCATCGGCATCCTGGACATTTTTGGCTTCGAGGTGATGAAGCGAAACAGCTTGGAGCAGTTGTGCATCAACTTCACGAACGAGACTCTGCAGCAGC
AGTTCAACAAGCACGTATTCGTGCTGGAGCAGGAGCGATACGCCCGAGAAGGCATCG