Description :
From Genome Similarity Track
Location :
Scaffold_175:6336- 8511
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh-piw_contig_175-abinit-gene-0.51Conserved hypothetical protein

Sequence
2175 bases(100 bases per row)
ACCGGTGGCAGCAGCAACAGTGGCTCGCTGGGCTCTTCTGGGACTGGGACGCTCGAGTGCTCCTCGTACCACCACTACGGCAGCGTCAAGTACCTACAGG
ACACGGACCCGCTGCTCTGGGAAATTCACCCGCACGACCAGCTCGGGATCCGCAAGAAGGCGACGCTCGCGCGCACCAAGAGCGACTATCTCGCGATCTT
CTCCAAGTACAGCACGACATTCCGGCAGATCTTCCTGCCTCGGCCGCGACCCATCTCGCTCGAGCAAACGCTGCGCGACATCCTGCCAGAGCTTTTCCTG
ATCAACAACATCCTTTACGGCGGCGGTGAAGAGAACAATGGACTGGAGAACATCTTTGAGGTGCTCGACAGCTACATCAAGCGCTTCGCCGGTGCACAGG
AGGAGCGCGTGCGCGCCGTGAGCACACTGCTGCAGGCCTGTGCACGCACGATCAGCGGCGGCGACTCGTACTTTGTGATCCACAGTCTCCTGGGAAACCC
GTTCATGATCATCCGGCCTGCAGAAGCGCGAGGGCACCCGATCGAGATCGAGGTCTCGCCAACAAACCCGTGTCAGTTCCTCATCACGGTGTTCAGCGCC
TTCTCGTTCCACCACATCGACGACGTGGAGAAGTACGGCGACACGTGCGACGGCACGGCCATGACTCCCGAGCCGTTGCTCCGCGTGAAGACGTACCACA
TCCAGGAGTTTGACTTTGGCAGCGGCAAATCCTCGCGCTGGCTGCAGATCCGCACGGATGGCATGAAGGACGACGACCGCGACGCGCAGTTTCGACAGAC
GTGGATGAAGCGAGAGGGCTCCGAGACGGGCTTTGGCGCGCTGCTCGATGCGCTTTCGTAGCACAAAAGCTGCACGCATGTCCTGTCGACTTCTCGGTTA
CGTCCATGGCTTCAACCGGAAGCAAGCCACTTGGTTCACCAGGCCCGCTTGCATACCAGGATAAGAGCTCATTGAACAGCGCGTGGGTGCCAAGCACAGG
CTTGTTCAGCACGATCATCTGGTGCACCTGCTCAGCGGCACACAGCGTCCGTGGGCGATGAAGCTCCTGAGGTTGAGCAGCTGCAACAACCAAGTCTGAA
TGGCGAGAAATGTGATGATAATTTCGGCTGCACCTCAGAGTCCGTGCCGAAGCGCTTCTCAGGGGCTAAATACGCTGGGGTCTCTCCTCGTATCGTGTCA
TGTGCGTCAACAGGCTCAATGGCGCTTAGCAAGTGAACACACGAACAGGCGATTGCAACGTGCGAACCTATCGCAGAGATGAACAAAGATCACACTCGCC
AAGGAAAGATCACGAACAGGTGAACGCAGAATAGCCAGATCACTGAACAAAGGAGGTTGCTGCGATTTGCCTGCATGGGGGAACACGCTCCTTAGCGCCC
GTCGGTTTGCGCTCGAAAAGTCACCGCGTCTGGATTTGCTCTGAACATTAAGCCGCTGCCAGCGAAAGAGGCATCCCAGGTACGCTTTTCCGTATTCCAT
GGACTACGAATACAGGTGACACGTGACTCGTTGCACTCCGACGGACTAATATTCACATGTAGCCCTCCATTTATTAAACACGCAGCTTTTGTTGTATTCC
GTGGGTGTTTCTATCGTGACGTGACTGAACAGCCATCCAAAAATGAAGAAACTCCGCAGGAGTTTCGCCATCTCCCCAGCAACAGCTGACTGCTCACTAG
CGAGATCGCCACTGCCAGCTGTGGTCTCCAGCGCTCATGAAGACAGTAGAACTCTCTCCAGTCCGACACTCCTTTGAGGATGACACTTCGTCAAAAGCAC
AGAGAAGCCGCCTACCACTGACACCACGGCGAACGTGACCCACCCTACCAGTCCACTGACGTCTAGTGACTCATGCGCACATTGCGGCAAGCCTCTCGCC
AACAGCAGCACTCGTGGCGACGAAGACGGCGACTCAGCGGCAGAGGCAGAAGGCGAGCTCCCCGCACAAATCCGCATCCAGTGCCTGACGATCGTGGCAG
GAGGCGTCCTGTGCGTCACGATCGTTGGCATTGCGATGTGTTTTTGCGTTCACAACGGCGGCATCGTACTCGAGACGTTCCAGGCGATCGATAAGGACGA
GTCCGCGAGCAAGAAGCTGCTGAACACGTACAACTTGTACTCGGGCTCGCTCACGTTCGTCATTGTCGAGCCCGT