Description :
From Genome Similarity Track
Location :
Scaffold_194:63358- 71275
Sequence
7917 bases(100 bases per row)
ACTTCCTCTAGCGCAAGGTGCTGTGTGACACCGTCACACTTGGTAGCACTAGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGAAGT
TCGTTGCCATGGATAGGAACGACTTCTCACATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGACATCTTCGGGATGAAGGTGCAGAGCCT
GGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTGATCGCGCATGTGCGGGAGAACCTGCAGGCTCCG
GCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACCGCTGACGGTTAAGCCGTATGAAGGGAAGGAAGGCGACAACCTTCACTTCTGGGACCGAGAAG
TAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGTGTGTTGCTTTTGCACTCGCCAACCTTAGCGGCCGTGCTAAGAGTTGGGTGTACAC
ACGGGAAGCAACATCCCCTGGATGCTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTACCGCCAGCGT
TCGCGCTTCCTCTCGTGTAAACAAGGAAGGCGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGACACCCACTCAGCG
AACACATCAAGATGAATGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAGCACTCTTGAAGAGGCGATTCA
AGTGGCTCTTCAAGAAGGGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCATGGCCTGGGAGTTCTTTGTCGGCTCCCGGCCGAACAAGCCCCAAC
GGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGCGGGATGATGGACCACTTCAAGCGCGACTGTCCTGCGGAAA
GACTCCGCAGACAGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTAGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCTGGGATCCAGTAGGGGCGGGG
CGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCCTACCACGGGGACTTAGCCCCTGAGAGTCTTCACAGTCTCGAATCGGCGA
AGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGGATACGATCATCCCTTTAGAATCTTTGATCGATTCTGGGGCGTCGAAGAATTTCGCA
CGCCGCCAGACGGTTGCTCGCAACAGTAACAAGTTGTCCGATGCTTTGAGAGAGCGCAAGGGCAACGGGAACGGGTGTCATTGCGACTGATCCGACCATG
AAGGTCGCCAACGTCCCAAGTGGAATCTGGGCCGTCCAAGTTTGAAGACTTTGACAACCTCCGAACAGCTCACTGTTCTCAATATGAATCCTATTGATAA
TGAATCTGGGCATGGCCCTGCTTGGGAAAGCACGATCCCGGGATCGCTTGGCGAGGCAAGGTAATTGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCAT
TGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCAAGCCTGCCAGGGTACCAAGGCATCCGGCAGATGCTTAGGAGTCGTCGACGTATAT
GACGACTCCGAGGATGTTTTGATGGTGGCAGCGCCCAGAAGAGGCGCTGGCCAAGTAGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCACGACA
GCTGCAGCTGTCACGAACACTGAGAACAGCGTGTTCAGAGGGGGTAACAGAGCTCCACACACGGTCGCCCAGACCCTAACTGAAGAGGAAGATGTCGGAT
ACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTCGAACACGCTTCCTGTGTGGGTACCACAGTACC
ACACGAGGCCACGAGTGCCTTGGATGTCGTAGCGCCGACATCCCTAGACGTGGGCAGCAAAGCCCGACGTCACGGCCGCCGTCGTCAACGACGCCGCCGC
CGCCTCAAGTCGGATCCGAACTTCGTTACGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGTT
ATCACATCTTCGATGGCGAGACCGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGCACCTCGAGGAAAT
GACGGCTGAGGCTTTCCTGACCAACCTCAAGGCTGGAGAGATTGCTGAGATGGTACTCATGAGAACTGAGACCACTCGGGAGGAGCTGAACTCCTCCTCT
GTTTTGGACGAGAACGTCCTGGAAGACCTGAACAAGCAGCGTCAGATGCGCTTGGGTTCTGAGATTCTTAAGAACCCCAAGGATCCGGTGTATTCTTTGG
TGAAGGAGTATGCGGACGTGGGGAACAAACACCCACCGACCCAACTCCCACCGGATCTAGGCGTACGGCACGATATTGATCTCGTGCCCGGCACAAAGTA
TTGTGTCACGAGGCAATGGCCTCTCCCGTGCGAACAGAGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAC
TCCCCGCACTCGACGCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGGCGGCCC
AAACAACAATCCCGAAAAAGGATGTGTTGTTGAACAATATGGCCGGGAGCGTACTGTACAGTGCGCAGGATTTGGTAGACGGATACTACCAAATCCTGAT
GCGAGAGAGCGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACG
TTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACAAATTCGTCCATAGCCGTGCCGAAGGAGGCAAGA
CGGCCATGGAGGTGCACCTAGGACACCTCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACC
AGAGATTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAG
AAGGATCTTCGAAAGTGGATGGGCTTGGCCAACTACCTTCACAAGTAAAGCGCAGGGTACGCGGGATCCGCTAAGCCCTTGTCGGGCCTCCTTCAGAAAG
ACGTCGACTGGCGCTGGGAGTAGGAGCACCAGGGTGCCTTTGACAGCATCAAGGCCAGTCTCCAAGAGGTCCTTGTCCTGGCCCTGCCGGACGAGACGAA
GCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGATGTGCATTACTGCAGGCCGACACGGCTGGACACGAACGAGTCGTCTCGTTCCAGTCC
AGGCAGCTCTAAGCCGCCGAGCGGAACTACCCTGTCCACGACAAGGAGCTCCTGGCAATGAAATTTACCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCT
CTAGGCTCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCCGTCCTTCTTCGC
GGAATATAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGATTGCGGACGCCCTCTCTCGGCGTCCTGACTATGAGTTGGTCCACATCACGCGG
GTGACAACGGATCTATATGATTTGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTATGGCCGGAACGAGCGCGAAGT
CCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGTCTCCTCTATTACCGGGTGGAGCCCACTGATCCTCCACGGGT
GGTCGTACCCAACGACGAGGATCTGAAATTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGAACTTTCTGTCG
GTCTTTCAGTCCTTCTGGTGGACCCACATGTACCAGTGGGTCGCCCGGTACGTTAAGACATGCGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTT
CGGCTCCACTACAGAGCCTGCCCGTACCGGCTAACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACATCGG
AATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTACCGTCACTGTTACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGC
GTGTTCCGCTATCACGGTCTCCCGGTGACGATTGTCTCGGACCGAGACTGGTGCGTTTTGGAAAATGCTGTTCCCTTTACTGAGAACTCGTCTGCAGATG
TCCACTGCGGACCATCCGCAGACAGACAGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGT
GGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACCCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAG
AGTGCCTCTCACTCTTCGAGGAGACACTGACTGCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGAATGTGAGACCAGTT
TCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAACTGAGCATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAGT
TTTCAGACAAACGTGGAAGAGGAAACTTACGTATATTTGAGGTTGGGGACTTAGTGTTGCTAGACACGAGGAATCTACCTCTTGACACTGTCAGCTCTGT
CGACAGCAACAAGCTGAAGCACCGCTTCATCGGACCTATTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACG
CACCCGACGTTCTGTGTCGGACGTCTTAAGCGGTACTTTGACTCGGAGGGGGTTGCTGACTCGCAGACCCTCCTTGACCTAGCTCCTCGAAGCGAGGGCC
GGTCACAGTCGTCGACGAGGACGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGTCTCCATACGAA
CGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACA
AAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCAA
CAGGTCCAGGCGGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATCGCCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACG
AGGACACGTTGACGGAGGCGGTCAACCTCAGGGCCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTTTCGGGAGGCGCCGAGTACTCGT
ACTCGTACGAGGGCACCTTTGCCCCTGCTTGACCGGAATGGAGAAGTCCTCTTCCACGTGGAGCGGATTCTCCAGGAGCAACGGCGTCGCGGTAAGCGAC
AGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAGTCTGGGA
ACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGACGATGAATACATTCCGTACCCGCGCTCATCGTGAGCGCTAG
AAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATGCGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCATGCTGGTCCAGGATACGGGACAGCAG
CTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTTTTTAAGAGTCCCCACCCATGCCCAGAACATGTCCTCACAGGAATTCCACGTGGGACAGTTC
TCGGGCATAACCCAGGGGTATCCCCAAAGAGGATAGAGCCACCCCGGGTCTCAGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTGG
CGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCAACGAACAACTGTTTTTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGCC
CACAAGGCCACGAGGAGCGACGAGAATCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGACCAATACCCTCTTGAGTTGATGGCAGCTCCCTGG
CTGACAAGTGCCACCACCGAGCCCCCACGCACACGCTGGACAGCTTGGAATTCCTCCTGCTGTTGGTCGAGGTCACCCGAGACCTCCCGGGGCTCAACGA
TAGCACCTTCCTCCTCCTCCTCTTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGTCAAAGATACTCTGGTAGGAGCGTCAAGTTTCCTTCTCCTC
GCGGAGTGGAGACTTAGAGGCTGTACGCTTCTTTGAGGGCTTGGCGTCTTCGGCTTTAGAGGCCTTAGCACGCGCAAGACCCTCGGCAAGCGAGAGACGT
TTGCGAGGATTCTCTTCCTCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTGACGGCCGGACTCTCGGAGTGCACAGACGTTCTGGGACTGTGATCAC
CTTGATCACTAGCGAGCGACTGCACGCTGTCATCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTTCCACAGAGCCCACAGGAGCATCGTGCGTGCTCTC
GGACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCACGTTCCACGAATCGAGGGTTCGAACGATTGTCTGAAGGAGAGAGCGACGGACTGCGGCGCTTG
CCCGCTCGCTTGTCCACAGCCGCGTCACCCGAGGAACCGATCGCCTCGGAAGTCACCTGAGTAGCCTCCTTGAGTGCCGAGCCTTTGCCATGAGGCTTAG
TGCTCTTAACTTGCGCCTTACCGGCAGCAGCCTTGGAGCGTGTTAGCACCGCTCTTTGCAGTGCCACGAGGCATGATAACGGCCGAATTGGAGACCTAGA
CGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAG
TTTGTGACGAGCACCTCTTCACTCGGATTGGTCGGTAAAACCGAGCCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCTAAGTTTACCCTGGTTACA
TGAAGTGTGACACTTCACACTTCAGGTGTATCGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCGTTCAAAGCCAACCATTAGTCAAACGACAT
TGCACTTCTATAGGTAACTTATAGTTTGTATTAAACCCAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTC
TCTTTAACTAAAGAGGGGACCTGTGACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCA
CACTACCAAAGCCACCC