Description :
From Genome Similarity Track
Location :
Scaffold_194:63350- 66257
Transcript NameFunction/comments
Hyaar_Emoy2812339reverse transcriptase

Sequence
2907 bases(100 bases per row)
CATAGATGTGCGGGTACTTGTGCAAGTACGCCGCTAGCCCAATGACCTTTCAAAGTTCCTTGACATCGACTGGCACAGGCCAGTTGGTAATCGCCTTGAT
CGTTTCCGGATCAGGGCGTATAGCTTGTTTACCCACGATGTACCCAAGAAGTGGTATTTCGCTAGCAGCGAATATACACTTCTTGAGATTGGCATACAGC
TTATGATTCCGCATTAGTGTAAGAACCTGACGAACGTGTGTTCTATGAACCTCTAAGTCCGTCTTTCCATCCATAGACCGGTTATGGACGAACACATCGT
CAAAGTAACTCGGTCTCAACAGATTTGCTACACATCTGTTGAGCGTTGCAGGGGCGTTACTTAGCCCCTGCGGCATCATTAGCCACTCCCAAAGCATACC
GCTGCGGGTGCTCACTGCTGTGTATGGGATGTCCCGTTCACGCATTAGTATCTGATAGAAGCCATCCATCAGATCCATGGACGAAAAGATGGTACTTTTT
GACATACCATCTATGATTACGTCCTCCCTCGGTATCGGCGTTTGAGCCGGTACCGTTGCAGTATTCAACTTGTTGAATGCGTGCATTATCCGCCACCCTT
TCGTGGCCTTTCACAAACAGAAGGTCGGAGAGCTGTGAGGGGAAGTTTATTCCCTCACATGGCCCGCTGCAAAGCGATCGGCAAAGAGCTTGTAGATCGC
TAGTACTTGTTCACGAGGCAGTGGCCACTGCTTCATGACACAGTACTTCGATCCCGGTTTGAGCTCGATCTCGTGTCGAGTGCCTTTGTCCTTAGGCAAC
TCGCATGGCACGGATTCAGGAAACACATCCTTGAATTCGATCAAATCCTTATACAAAGGATTTGTCTGAAGCGACTCCCAAGATTGAGACGTTTGTCGTT
CAATCTGAGTCTTCTCATCGAGGACACTTTCGTCCATCGATGAGCTACTGAGAATCCGTTCGTTCTCAGCAAATACTGTTGCCGACCGAATATCGGTCAC
ATACTCATCCTCTGTGATGAGTATGCAGATCTGCTTGGCCTTGCCACTACGCAGATCACGCAGGAACCGTTTCGGTTCCAGCGTTGGCAATTGAGTTATC
TCCGAAGTTAACTTTGGAGGCACAATTATATCAAGCGTATAAGCGCCTACGCTTGATCCGTCATTGACCAAGACATTCAACGTCTCGGTTTCTTCCTGGG
AACTTGTTTCTTCAGGTTGCTGAGAGCCTGTTCTCTCAGCATGTAACTCTTGAGGAATCCTTTCCTCAAGTACGTGGGGACTTATTCCCTCGACGTCTTC
TGACTGTGGCTGTGCAACCACAATCAGGTACCTATCCTCTACGGTTGACTCTCCAGTCAACCTAGGATGACCGTGTTGCCCTTTGGTGGCAACCGGTTTC
TTCTTCCTAGGATGTTGCCCACTAGGCATGCATCTATGTCCCGTTCCACTCGACTTATTCGAGTGGTGGACCTTCGGCGCTGCCTGTACTTCTGTACAGC
TGCCGGGAGATTGCTCCACAGTGTAGGAATCAGCTACACTGAGGTCTTGTGCAGTCGTGCTAACGACCGTACCGCAAGTGAGGCCATCGCACTCACTCGC
AGTACATCCACACGCTTGTGGACGCTCCGTGACGTTCATCAGATGGCCATCTGATGAACAAGCGGCAGGCATCTTCGCGGATCGATGCTGCAGCTCACTC
TTGGCTCGTATCTTCTGAGCCAAGGTAATCCCAGGATGCCATCAAATGTGTCATCCAGATCCAGTACGATGAAATCATCCTCGTACTGTTCAATTTCTAA
CGTGTAGTAGATTCTAACTACACGTTTCTCAACGGTTATCGACGCGCCTGTGGCAAGGCACACCGTCATCATCGTTTGAGGGATGTCGCGCTGAAAGAAC
TTGAGCCTAGGACCCTCTAGCTCTGACGACGAACAAAGTTGTTCGACGCGCCACAGTCGACTAGAGCACGAAGTGACAAATTATTTGTCACTTTCAATTC
CAAGGTGATGAGTGATACCTCATTACCAGGTGCAGAGACACACAATGATTGTGTATCTGGAGCAACTTTCGTCAAGAGATTTGCAATTTCTCTTGAGGTT
GCTGGATCAGTAGGGCTCTCCGCCCCTACTGACCTCGACCATTCTTTGATGGTCCACTTCGCTGTTGCGGTTTCGCAACAGCGTTAGACCTACGCCCATT
GTCCTTTCTGGCAAATGGCCGATCATTTCGCTCTGTAATGTTTGGTACTGGGCGTGGGGCACTACACTCGTAAGCGTAGTGTCCCAACTTCTGGCAGAGA
CTGCTTTTCTGCAATCGCTTGTTGTTCGAAGAGCGAGGTCTCTCGCTCTCGACATAATATAGGTCCATTGGTTCTGGACCTCCAGTCTCTTGTCATCTCG
GTGGACGATAAGAACTCGAGCTAGCATGAGCCTGTCTCCTGCTAAATTCCCCCTGTTCCGCAGCTGAGATTGCTTGTTCAAGAGTATCCAACTCTAAGCG
GAACAGGTGGTTCCTGACGGGCCCATCTACGAGCCCTTGCATGAACACAGTAATCAACGTGTGTTCATGTACTGAGTTAGCAACTATACTACTCGCGAGG
AGTCGTATATGTTGAGCGTAAGCGTGCACATCACGCTTACCCTGCTTGAGTTTCAGAAGCTCTGATCGATCCCTGAACTCAGCCCGTGGCGGCTCAAACG
TCTGTTTGAGTCGAGTTTGAAAGACTTCCAGCGACCCAAAATCATATGGGTCGCTCATCTCCAGCCCTAAGGCCCAAGTCTTGGCGCATCCCGCCAAGTT
GGCTTGAGCAAATGTGAGTTTCATTTGCTCATCGTCGATACGACGTGCCTTTATGGCTCTGTCTAGTTCGACGAACCATAACAACAGGGAGTATTCCTCC
ACTCCTC