Description :
From Genome Similarity Track
Location :
Scaffold_40:633345- 640926
Transcript NameFunction/comments
Phyin_T30-4PITG_15689Putative uncharacterized protein
Phyin_T30-4PITG_15690Serine protease family S33%2C putative

Sequence
7581 bases(100 bases per row)
TCTCCTTCGGATCCAGTATCTCACGATACGAGATATTAGATCTTACAACCTTCATTTGGTTCCTTGTTGGCATTGTCGCCCCCCCCCCCTCCGTCTAAGC
TGTTACGACTTCCGTTCCGATTCGTGATTGCTGGATCCAGATCGTCGTGTTTGGAACCACAATACCACTAATCCCGAACAGTGTCCGGGAGTCTTCTAAT
TTCTTGAAAAGAACTTCACCACAGCCGCCCAACGGTGTCACTGCGCACACCCAACAACGTGCTCATTTTCCCATTAGAGTCTCCAAGCACAAGTGACATG
GTACCATCAAAACGCGCCGACCAGGGGCACGGGAAATCGCCCGTAGCCGCGCCTTCCCCCAAGTCTCCCTCGACTCCGCCGACTTCGGTGGAGGATCTCC
GTTTCTTTGTCCTGGCGCTCATCAACCAGGCTACTAGCCTGACAATCAAGCTGCCGACTGTGACATCCGAGCGGTATCCCACTTCCCAAGAACGGATGCT
GACCTCAATTAACGGTCGTCGCCAACAGGGACTCCACCAACGGTACCCAAATTCGTGATCTCCGGTAGCAGATCCACGGCCACGCGCTGGCGATCCAAAG
CTGGGAACAGCGGAGATGTTTCGCAGATCAAGCGCTAGAGCTGCGCTTTCTGGAGCAGCGCCCCCAGCAGACGTTAGATCGGCAGGGTCAGCTACGAGAC
TCCAATGGCCATCTATTCCGCGAATTCAGTCTTCGTAAGCCATGTTCTTCCCCCCAATTGACTAAAACAAATTCCGATCTGAAATTTTCGCTCTCTTAAA
TCGTTCAGTCCGACATCTTCTACACATGTCGATCTTGGATTTAAGCCCGGTGCTGTACACGACTCTGAGATCTGGGCACTTGTTCCGGACCCGCGTCCTC
CTCCTCCTCAGATCTCGCATCTCTGCTTGTTATTTTCGTGCACGTCATGTATATACGTATGCATAACATCATCGCCCACCCTTCGATCTACAAACGCTTT
GTAGATCCTTCCACACACCTACCCAACGCGTCCTAACCGCGTCGGTAGCTCCCTTCAGGTTACTCCTCGTGAGACTGCATCACACCGAACCTGTTTCGAC
TGGTGCAGCCCCGTAAGAAAACCGTACAACATAGCTCCACAGTTTAGATCGGCCTCGTCTACCCAGCTAGTTTTTCGTCATATCCACGCCAATGTACCAA
GAACGCACGGTAGATCCGACCGTATCTCGTACTTTGATCGGCTCGGCTTGCAGCATCACTACCAGCTTCTCATTCACCAATTCAGTCAAGTCAGGGGCTC
CGCTCGTCAAAAACTCCCGAAACACGCCAAACTCAACACCACTTCTTCCATCACATCTGGTCACGTTTTCTGGCCGTGTGCCGTTCAACCGTTCTCGCAC
CCGCGTACAGGGTTGCGTACTCCACCGCTGCAATGAAGCATCGCTGTCCACCACCGGTCACAGGTAATGGAACGGCCACATCTAACGCCCATCGATCACC
CTCTGCCCCCCCCCGCCCCTCTGATCACCTCACGTGGCTTAGCCATACGGCTACAGCACTCCTGTCAAACGCATACCCAACGCTTCATCACGCTACATGT
CTGGCCACCACTATACTTTCGTATGTGTGTGGCGCCCTAAGGTTCCCTGCTTATACCGAATAATGGTGCACCTTAAAGGCCACCGGCCAGAGCTTTGGTG
GTGGCACCACCCGCCGTTCATCTGGCGTCTTGATTGCCACCAAATTGTGCCGCACCTCAACAAGGCGTCTTGATTGCCACCAAATTGTGCCGCACCTCAA
CAAGGCATCTTCCGATACGCACGAGCCTTCACGATGCGCTGCACCAACCGACTGCGCAACTGAGCAGCGATGATTGACTCATCCATCAGCTGCAACGTCG
GTGGCTGACGCTGCTCCAACTGGTCCCCCGCATCCTCACGAAGTGGAATGTGCATCATGTTCGTCATTAGCTGTTCCGCCTGCAGCCCCACGTTACCGCG
TATGGGATAATCGCGCCCCGCTCCTGCTCCGACCATCGTCGTTCGTGTGCCTACCACCACCAATCTGAGGACACTGGATTCTGTTGATCGTCACTCTCAC
TCTCTGCACTGCCGCCGTGGCCTTCCGTCGTCTTGCCGCCACCCGTCGTTGTTCGAGCTCCTGCGGCGCTTGCTCTCGCTCCGCTCACCGGTGGTCCCGT
CGTTCGTTATCAGCGCGCCGTCGCTTCACCACCGCCTTCTGCTTGCGCAGCTTTCAGCGTTCGTTCGCTCTCTTCACCTGTTCCCACTTGACCGCCTTCC
GCGCCTTCTGCTGTGCCTGAAAAATCCACGCCACGCTGCATTCCTCGCCCCTCGCCTTCTCCTGGCCCTCTACCGCACCTGCTCCGGCGCCTTCACATGT
TCGACCTTCAAAGCTGCCGTCACCACGTCTGTCCTCATGCGCATCCTGCGCCGCACACGCACGTACCGGGCTCCGCTAATGTTGGCTGCACCGTGATGTG
CCAGCGTTTGGATCGCTCCTTGTCTCTCTCTCGCCCGTCTTCCCTCATCTTCTTTACCACCGCGTCCACGTCTACGACGCGGTCGTCGCTCTCACTCTCC
TCTTCGTTTTCAGGCAACAACTCGCTCGCTTCACGCGCTACCACTTCGCTACCAGCTCTGCTACCAACGGCGTCGTCTTCGCCCTTGGCCTGCACCGGCG
GCTGAAAATCTGGAATTGGTGTCAGTCGCTGTGGTTCCCTTACACCGCTCGCACCTTGTTTTCCGCATTCGCCCCCGCTTCTGTGCGCCGCATTATGTGT
ACATCGCTACGAGCCATCGCTTCGACGTCCGGAGATTCGCGCGCGAAGCGCCCAGGTTTGTTACATGCGAAGAACTTCGGTGGATAGGGGCATCTCGACC
GGATGTATTCAGGTTTGCCGCGCCTAAAGCACACTGGCGGCCCATTACTCCACGGTGGCACTGGCTCCGCCTTTTCGTCTTTCCCCTTCATTTGCCGCAC
CGTCGCTTTCAGCTTCTTCTTCACTGGCTTGACGTCTGACTCATCGCCGATAGAGCCACGATCACGCCGGTGTCGTCCCCCTCGCTCCTATCGCTTGCTT
CCCGACTGTTGCATTCTTGTTGCCCTTCGACGCTACCCAAGACTTTCCGTCCCACGTGCGCCCCGGTGCCACGTCCCACGTACCGGACTCGTAGTTCCAG
ACGCCTTGCTGATTCGTAAAGAGGGCCATTTTCCGTGCCTCACTATCTGCAGACGCCATACCGTGGTTCATTATTAAAAGACACGAGGGGAAGCCCGAGT
CTCTGATTCCAGGTATCACCATCGTTCGCCCCATCGTACCGGCCATCGGGATGACGTAAGGGCTGAAGGCGGTTGCCCAGGGTTGACCGATGTTCATCAT
ACCTTGCGCAACGTTGTCGTGGCCGTGGCGACTGCCCTCTCCAACGTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACTCAGAGCCTCTACCCTGTGCTTCCTCCTCGAAACTTTCGCTCTACCTTCGCTCCCT
TCCGACACTCCACTTGATCAGTCACTCCTGCCTGATCTGTAGCTGCTCCCGCCCTCCTCTCACTCACTCGAACACTGCTGTCTGCTCTGCCGACGTCCCA
CTCCACTCCCACCCGTCGCCAGTCCGACCTTCGTCCGGCTCCGTCGCTCGCACGGCGTGGTGCTGCTCCTTTTCACTCTTGCCGGCTCCGCAGAGTTTTC
TTCGCCTTCGGTCGCAATTTACGTTGTGATCTCTCCACGGACCCACCGCACGCCTCGTATCACATACAACCCTCCTTCGTGCTGGATGACTTGTGGTATT
TAACGCCGCTCGTTCCACTGTCTTCACTCTTCTCAATGGCTCCTTGCTCTTGAACGTCTTTCACACCGCTCTCGTTGGCCTCGTTCGCCTCACCTATTGT
GCCCATCTGCCACGCCGAGAGCAACGAGTGCTACTTATCGTCCACGGGCCTTTTGGATCCGCTACAATTAAAATATTATTAGTACTTCGAGGTCCTATAG
TATAGGGAACCGAGCGAGTAGAATACATGCAATTAGCTAAGACGAAATTAGGTGTCAGCAGGTGCGTATAAGCAATCGGTCCCTTAATTAGCTTCATTGG
CTTCGGTGCAGAGCTATTGGATACGGAATTGGGATACTATCTCGAAGGATCAAATATTAGGTAGTAAGCTGACTGGCTTACTGTAAGAAATGAGAACAAA
CGGACAGCTGATATAGAACAGGATTATTCACTTTCTTCTCTAAGGCAGTTTGCTTGTACGTACGTTTGATGAATTCTAGAAAGCAGGTGTGCAGTTCAAG
CGCAGCTTGTATTAATGGCAGATTTTTCTTTGAGCAAAGCACGACTTTGTTATATACTTGCCTGATCCGAAAAAGAACTAACATTTCCTTAAATCGGCGA
TAACTTCGGTCGTACAGCTCCAACGGAAGCGTGGTTTAGCTAGTTTAAAAGCTCTACTTACGTAGCGTCAGCACGATTTTTTATGGACAAATTTCCCGCC
GATTGAATTATCACTTTATGAAGGGGTAGTGTTTTGTTTTCGCTTTGACGTCAAAAATTAAGAATTAAACTTTAAATATACTAGAAAAAACGCAAACGGA
GCTTAATCTAGTGGTATATCAGGAAAAGCAATTAAATCAATTTTCGCTTTAATTACTCTCAATCCGTGTGCATACAAATTCTCATACGAACTCATTTTAA
CCAATCGTACCCACCTCAGAATGGACATTAACCAATCATACATGCGAGTTTTTTTTAAAGAAAAAACAGTACCGTATAGTTTTAGTAATAGGCGACGTTT
GGTCCTATTTGGTCCTATTAATATACGACATACTGCTTCGACCAATTGTGTTCCAGAAAAAAAACAGTTGGTTACAGTTTACAATGTGGTAATTATAGGA
TTTGAAGACTCTAATTCCTAGGTTGCACTGTAACGTTAACATCCGCCCCCGTCTCACACACTATACTAAAACTACAAGGTAAAGATGTTGTAGCAGACTC
CGGGCTGGATGAAACTCAGTTTTCTGCCTCAGTTTCGTGGCTGCATTTCTTTATGCGCCGCCACAAGCTTTCTCTGCAGTGTCGAAAACGCGCCAAGGGC
GGAGACGCAGCAGAAGTTGCAAGGGAATTTAAAGGGAGGGTAATGCAGACAATTGTTGAGAGGGATTGATTTCAAGTAGTTAACACCGGTTAAACCGGTA
CGTATGTGTTAGGCCTGCGATGAAGACAGTGTTCAGGATATCAACAATGGTGTTGCTGAGCTTGAGCGCTACAAAATTATAGACGAAGAGATCAACTCAG
AGGACGACGTTTGAAGCGAATGCAGGGTCAGTGAGGACGATACATGTAGTGGTGACGATGCCGCTTAATAAACTGAAGCACTGCATTGACGTTTGACGTC
GGGAAAAAATGTGGACTGATAACTGATTAATAAATCTGTGCTAAGTCAGCTTTAAATCTTAGGATTTGTATGGGTACAGTACTGCACCCCGTTTTCACGC
CCTTGGACCTTTGATAAACTTCCGGATGTGATGATCCTGGATCCAAATTGACGATTGTTTGTAAGCTAAAATCTGGTTAATTTGCAAATCCTATATGGTC
CACTTGGGATTTGTAGGCCGACGGGTTTCCGCCATTAAGTACGAAATAGGGAGGAGGGGATGAAAGCCGACTCGCTCGGCAACACGAATCAATGCCTGTG
GTTTAAGATCCGTGTGCGAAGCACGCGGGCTTAAACCCGGGATCAAGCATGGCTTAACCTCGCTTGGCCCTACGGTATCGGGTTAGTGTCCATGAACGTC
TGTGTCTGGGTTTTGGAGGATGATAGAAGTCCCGCCAACTCCTCCACTTTTGTAGATTTGCAGTCTCATGACACCCGTTCCTCATCTTGTAAATGTGTAA
CAATGTACAGTACTGCACCTCGTTTTCGCGGGGGCAGCTCATGTTGTGGTAATAGGCAGTCTCTATCATAGATAGTGCCTATTACCATAGAGTCTATGCG
GTATGACCAACCTCTGATTACGGTTAACTGTGAGCCGACTTGGTACTCATACCCCCTCCCGTAACCAGGATTGGTATTGTTTCTTGTTACATGTAGTACT
GTTGCGGAAAGAAAAGTGGGAGACGTTTTCATATCGTTGTATGCATGCTGATCACGTACGGTACGTCGAGACGGTGTTGACACGCACTACGGTAAACATC
ATTAAGAAACTCGCACGGAGCTCGTAACATCAGCACGATCTTCATCAGCTGGAATGCAGCCTTACTGCGTCCTAATTCTTGTAGCTTTCTTCCTGCGGAG
TTGGACCGGGAGTAAATCAACATCAAAAACCTCGAATTCGAACGGGTGGTATCCCTGTGCCGAGTATACCTTCTCCGGTACTGGAAGCTCTGACGCGCAG
ACCGCAGAGTGTGGAACGTACTCAGCACCCTTGTGCTATCCTGGTGTCTGTGAAGCGCCAAAGTGGGTAGACCAGACTGTCGACATCTTCGTCAAGCGAC
TTGCGGCCGCTGACCGGGAGACTGCTACCAATGCCTGGCTTCTGCAAAGAGGGCCTGGTATTGCTTCCAACGATCGTAAGCCACGACGTGGATATTTCAA
CAAATAATCTCGCTTCTGAAATTTCTAACCTTTCCGTTTGGTGTTTCAACTGTAGTGGAATCTAAAATGAGCACCTTGTACAAACAGCTAAAAGGGACCG
TGAATGTTTACACGATGGATCATCGCGGCACTGGGCGCAGCACGTTACTGAATCGTCCGGCAGCCCAGACAATCACGAGCGGCTCACCTGGAGGAAAGAA
CATTGATCCTAAAGAATTTCCTTCGTGTGCCCAAGCACTGGAGCGTAAATACGGAGACCTCGCGTCATTCTCGACGACGAG