Description :
From Genome Similarity Track
Location :
Scaffold_514:6333- 7551
Sequence
1218 bases(100 bases per row)
ATCAACGGTGCGGGCAAAACGACCACCATGAAGATGCTCACGGGGGACATTCTACCCTCGGGCGGCGCCGCAACGCTCGGTGGGTTTGACATTCTCACGC
AGCAGCTCGAGCTGCGGCGCTTGATTGGCTACTGCCCGCAGTTTGACGCACTCATTGAGCTCCTCTCGGTGCGCGAGCATCTGGAGCTCTTTGCCAAGAT
CAAGGGCGTGCCATCTGCCGATATTGCCAGCGTTGTCCAGGAGAAATTGACGCAAATGAACCTCCAGAGCTTCGAACACAAGCTCGCGGGCACGCTGAGT
GGCGGCAACAAGCGCAAGCTCTCGGTGGCGATCGCGATGATCGGGTCGCCACCCATCATCTTCCTCGACGAGCCGTCCACGGGCATGGACCCGGTGTCGC
GCCGGTAGAATACTCCTCTCTCGTTGGTCGCTCAAAACGGCGATTTTGTAGGTTCATGTGGGACGTCATTGCGGACGTCTCGACAGCCAACAAGGAGTCG
ACGATCGTCCTCACAACGCACTCGATGGAAGAGTGCGAAGCGCTGTGCACGCGCGTCGGCATCATGGTCGGCGGCCGCCTTCGCTGCCTCGGAAGTGTCC
AGCACCTCAAGTCGCGCTTCGGCGACGGCCTCATGATCGACTCGAAACTCAACGTGCCGACGCCGGTCCAGCTCGGCGATTTCTTCGCACACTCGGTCCA
ACCCGTGTGCCAGGCGGCGAAGGATCTCGAGACGCACCTGAGTCGGGACCAGGTACACTAATGGTAGACCAGAGGATTCGTCATGCTGACACGCGGATGT
TGCGTAGCTCACCAAGCTGTGCAGGGACCTCGGGCAATCCGAGCGCGCGGGCTGGATCGCCAAGACGCACTCCACCGGGTATGCGCTGGACGCGGTCCTT
GAGCGCGACAGCACGGTGTCGCTCTCCCTCTTTTGCGCGTGGTGGGTCGGCGAGAACCAGTTTGTGGCCTTCGACAGCTTTCTCCGGTCGACGTTTGCGC
GCGTCGAGCTCCTCGAGCGCCAGAACGAGCACTGCCGCTTCAAGCTCCACGACAGCGTCGACGCCAAGCTCAAGCTCTCGGACGTCTTTGCCAAGATGGA
GGCGCACAAGGTCGCGGTCGCGCTCAAAGAGTACTCGGTGTGCCAGACGTCGCTCGAGCAGATCTTCAATGCGTTTGCGAGCCAGCAAGACGAAGAGAAG
GGCGTTGCGCGCGGCATG