Description :
From Genome Similarity Track
Location :
Scaffold_121:63326- 64676
Transcript NameFunction/comments
Phyci_240958conserved hypothetical protein
Phyci_96291conserved hypothetical protein

Sequence
1350 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTATGAAGTGGGAAAGGGGAACTCACTGCTTCTGGTGTGCTGT
GAAGATTAAAATCCGCCAGCAAGAGTGCTCGGAGGCGCTGTACGAGACGCTCAAGGGCCGGTTGGCGCAGGAGCTGCTGTGCCGCTGGTGGTACGCGATG
GAGTGGCCGCCCGCAAAGAAATCAGCGCCGGTGGGTGGCGACAAATCACCTGCAGGTCTAGCGAGACGAGGTCTCGTTGCTGATATGTTTGTCGTTGTGG
TGGTGGTAGAAATTGCATGGAGTTCAGGAGCTCGACGGATTTCCTGGCGCCTTCATCCGCGTTAAGGTACTGCGTTTTGGCTGTTGCTATCAACTGCTTT
GAGTGGGGATGGCGTTCATAGTGATTGATTTTTTTTATTCTTTTTCGTTGAATATCTAGGGTGATGACTTAGGCTCGATCATAGACACTCGGTCATCCGT
AGGCAAACCGTCGTTCCTGCACTTCTTCGCCATGCCCTCGGCGGATCTCCTCAAGTTGCTTCTTCAAGCGTACGACAAGCAAATGGAGGTCTTGGTGGAG
CACGAGGTTCGTGGAAAACGTTGTTTTTTTTGCGCTGAATACATGGTATCGACGCTGACGTTTGTTCTGAACCGAACAGGGACCAGATACGTCGCTGTTG
AAGGATCTGCAAAAGGAGCGCGCGTCGGCGTCCCGCATTGACCCGGATAAAGCCGACCGAAGCGTTCGGAAGGTGCTGAAGGAATTCGCCGAGCTGGAGC
GAGAGATCAAGGAGGTGCAGGCTCTCGCGCTCAAAGAGGAGGAAAacaacgatgaggacggcgacgaagacgacgatgacgaggatgatgacgacgatga
cgacTAGACAAGTGTGCCGCTGCTGCAGGTCGTAGAGCCCAACGAAAGACAACGCCACACACGTCAAATGTGTGGGAAATACTAGGAAGACAATCTAGCA
GCAAACAAACAGCAAAACGCCCATCTGTAGACGATAAACAAGTGCTTTTGATTTTGGTGGTGCGGCTTGCGTAGCAACAGCGGTTAACTGAACGATCACC
AAAGCAACACCAAATGCTCAAAGTACATACAAGCAGCATGCCAAAGGTCT