Description :
From Genome Similarity Track
Location :
Scaffold_15:6332- 12973
Transcript NameFunction/comments
Phymu_g1053hypothetical protein PHYSODRAFT_346522
Phymu_g1054hypothetical protein PHYSODRAFT_333242

Sequence
6641 bases(100 bases per row)
TACGAGCCTCCGTCGCAGCGGCCGCAGATCAGCTACGAACAGTATCTGGAAAGCAGCTCAGATTCAGATGTCGACCTGGAGATGGTTCTGCGGGCACACC
GAAGCGAACAGGACGAGGAAATGCGAGGACGTTCAGCATCGAGAAACGCGTATAATTACACAGGACCAGGAGCAGCCAGAGCTCGAAGTCAAAGCCATCG
GGCGTCAGCTAGGAGGTTACAGAGTCAGCACCAACATCAAGTCGAGGTGTGCACTCCCAGCTCCGCAGAGCCACGCACGCCGTCCTACTCACTGGCCCCC
AACGCCGACGAGTCATTTTTGAGAGCGCTTGCGCGGCGTGTAGTGGTGCTCTTCTCCGGATCCATGGCCAGACGGACGACACTCATTTGGTTCTTCTGGT
TTGCAGAGTTAACCTGTTTCAGTGCCGCCATTGTGACCATGTTGATGATGGCTGGAACGTTTATTAAAGTGAACGCTATCGGGGCGGGATTTGGAGTGGG
AGATCAACTCTTCTGGTCCGCTATGACGTTCCCAGGTCTCCTCCTCACGGCCGCCATTATTGAGACTGCTGGGCGACGTGTGACGCTGGCTCTGTTTGTT
TTCTGTGGAGATGCTGTGATGATTGTATCAGCCTGGCTTttggaagaagatggcgactGGTTTGGCTTATCTCTGGCTTTGGGAGCGATGGTGTTGGCTA
CAGGAGGCACGATAGGGGCTATGATCCCGTTTACCGGTGAGCAGTTCCCGCTTCTTACTCGTGCGTTGGGTATTTCGTGTGCGGCAGCGTGGGGTCACCT
CGGAATGTTCGCGGGAGTTTATCTCGTGCTTCGACGCGTCATGGGAGACGAAGCGTGGACGTGGCACGATGAAAGGTTGATGTTGGCTGTGTGTGGTGGA
GTATCAATCGTCTTGCTGCCTTTGATTGTGTTCATGGGGCCTGAAACACGTGGACGGGATATCGACGCGTCGTGGTTCGAGGACAACAAAGGGCTTCATC
CTCACGCAGGTGGTGTACTTTCAACAACACCCGGAGGTCCCGAGCAGCCTGTGACGAGAATTCGAGGCGTAAGTAAAGCCAACAGCCGAGGCAAAAGTGT
GGACAAAGCCCCCGAATCCTTGGAGGAAAAGGAGCCTCAGATACCAGACTCTCCATTCGACAGGAACTCTTTGAACCACGTGACGATGGCCCCAGCAAGT
TACtcgccttcagctgcacTCCATTCTCCTGGAGACTATGAATCATCCTCatgctcctcgtcgtcatcttccgGATTCTGGCAGAGGCATTCGGTTCGTC
ATTTAGGGCGTAAGATGAAACGCGCAGCTCACGCTCTTACTCATGGACCGGAGGAGAAGCATGTGGTGTATATCCCCGACTCGAAGCTCAGTGGAAAGCG
GACTATTAACGACCGATGCGATACCCTCCCAATCGATGACCTGGATCAACTGGACACAATGGTAACTGAGCACGAATACCGCCAGCATCGATTGAGCGTC
GATCAGCCTCAGCGTCAGTCTGTtttggagatgctggagcctGTGCTGTTGGAGTGGCGTCGATCTGTGTCCAgttcgttctccagctcggcacgagact
tgagcagcagcagcaaagcgaGTAAAGCCAGTAAACCGGAGCACAGCGCTTCGATGTCGACCGATATGGAGTCTGCTACCGCTGTATCCGTCCGTTCAAG
TGAGACGGGGCGCTACACGATCGATCTCGACATGTTCGACACTTTCACGTATATTTCTACGCCCGTGTTAGGTGGTGACAACTATTCGGGCCACGAACAC
CGAGAACCGAGCAATCTTTCATCTACTAGCAGTGAGATGAAGCAAACATGCTGATCTTGACGCGCATTTTCGAGCGTATGTATTGACGAAGTGTCATTAA
GTTACGATAATCTAATGTAGGTTTTGTTTTAAAGCGTCTGtctttattttttttaacaACAAAAAAATCTTAAATTGAAAGGATCTTTTTAAAACGGACG
CATGGCTAGTTGGGCAGTGTGTTTCTTGTCTTTCGTGGCTTGGATCTCGAGCTTAAGCCATGgcgttgacgctgcagaccCTTGGCTTAGAGCTCCCCCC
GCGTTTATGCAACTTCTATGGCCGAATGCAAGTCTGTTGCAGGTTTCGTTGACGGAACCAGCTCTTCTTTCAGGCACTAAAACCTTCTACACGACCGATT
CCGTCACTGTGTTAAGTGTTCGCAACGCTACAGTGCTCGATAGCTCCAGTCGAGCGACATTCGAGATGCTTTTCCTGATCGGAGACGCTACTCAAGCATT
TACTACCACAGTAAATCCAGCTCTGAATACGGTTGGACTTGCTACAGCTttgtcgaacagcttggAAGCATCCGTTCGTACTGCTGCAGGGGACAAGAAC
TTGTCGGAGCCTCTATGGCAGGCTGTCACTGCGTTTCAAGGCAATGCTGTTACCTGTACGTCTCTCTTAAGTGCCGACGTCCTCACACTTTACAAGTCTG
CACCCAACTTCCCGGCCATTCGAACAGGAGCGACgccaactggaactgctttCTTAacgttcagcgtcttcttccggAACGTCAATGACCCGTTAAAGCT
GCCACAAAGTGTGGTGTTTCAAGTGCGACGTGGCGTAGCAGAGTTCCTGGGTGGAGACTTTAACCTGAGCTACGTCGTCTCCAGCGGCCCAGCGACTATG
GCCACAGACTCGACGCTGCAAGTGAACCAGACGTTCTTCTTAAAGCTCCCAGCTACTGCTGATACTTCCATGAAAGCTCGTCAAGTTCTCGCTAACCGTG
TGCTGTTCGGAGACCTCCATCGCCTTGTACCTGGCACTACCCATCCCGTTATGTTCCTggacttcatcttcgcttcCATGGAGCTGTCTTCAGCGTTAAG
CTCGCTGGCTATTGCAGGCTCGCAGTCTTTTGCGGCCACGTTGACTCCATACGTTTTCCGCTACATGAACTTCGATACTTTCCCCCTTGGAAACCCAGCA
CTTCCAGAACCAGTAGCGGATACTGCAACGCTGCTTCATTCGGCATCTCAAGACGCTTGGAACGCTCTTCGtcggaagaagctgaacttCCACTACAATC
cggatggctacactgcAACACTACCGAGTGATATCAGCTATCCGTCGACTGTCAGTCTCAATAACTTGGATCTCGATGGAGCGTTCAGTACGACAGTGTA
CTGGGCCAACACGTTGACGCACGAGTTCTGGTTGGAGAGCGCCGAGTCGATCGATCCCGTGGCGTGGAACCTCTTCCCCCATATCTCCCTTTTCACTGAA
GAATCAACCTCTTTTACGCTTCTTGCTCCGATTGTACAAGTCGGAAACACATCGACGCCACTATGGACgctacaagctgcagacCCGGAGAAATTGGATG
TGGCTTTGAACTTCCGAAGCGCAGACAACAGTACCGTAGTGAAAGTGGAGCTGGCTGTTACTCTACGTCCATCATCAGGCGACGCTGAGTCCACAGTCAC
AAGCATCGCTCGCGCTGGAGGTTCAACTGGTAGCGTCAGTCCGTTGAATATCGTCGTTCGCCACCAAAGCCGGTTACTGCGCCATGGAGAAGTGAGTAAA
CTGCTTCTGTACCTCGAGTTCGGCTTTGCAGACGTCACGGAAAAAAGTGCCGATGGCTGCGCACATtgtcagcagcttctggactGGTGCTCGAATGAAT
CTGGGTGTGCAGTGCTGAAAACGTGCGTGCTTTTGGCTATTCAGAGCCCCATCGCCAATCTGATcgcgacgtcgacagcaatTGAAACGAGTGATCTCTC
CTCTCTGGTTAACGCTTGTCTGGTCGGTACAGCAGCGTCGCCCGTGGATGTGAATGATCTCATGCTGTTCACGAGCGTTATCCGATGTCAATTGAAGCGG
TTGTGTCCCTTACAGCCTACAAACTCCAGTATCGTCATTCCTTCCGGCCTTCAACTTGTATGGGGGAATGCAGTTGGACAGCAGCGTATTCAACCGGCAa
cgaacgtctcgaactTCCCCGAACCGACCAATTTGCCATTGAATATCTCCTTGTCGATCGGTGGACGTGTGGTGTGCTACATTCCCGTATGGAATAACGT
CACAGCATCCGTattggagacgaagctcacACGTTCCTGCACCTTTGCCAAGTACTTGGGAGCTGTGCGTGTCAATGTGACGTCggatgctgcaggagct
ACAGCTATAGACCTGTTTTACGACGGCATTATAGGTCCTCTGCCTCTGTTATCGTCTGTCTCCAGTACTGAAGCAATAGGAGCTACAATTTCTACCGTCG
TGGCTCCAAGTGTAAGCATTCGATACATTTCTGCTGGTGGTCCGCTTCCGTTTGCTGCTACTACCGATCGCCCACCAACTGACGCGTGTGTGGAGTGCAA
GCGACTGGCGTTGGACGTGTGTCTCCGTGATGCAAAATGTGCAGCTATGGCTGACTGTGTCATGCAACAAAGTAACGGCACGTCCACCGTCACTGTTGCC
ACCGATGCTTCCACTACGACGACGTCACTAGCAGACGCGATACTGAAACTTGTTCGAGCGGACCATACAGGCACTAAACTCTCATTTGAGTCTGGGATTA
CCTCTTGTATCCCAGCAACTACTACCAATGGGACATCCAGTGTGGATGTCAATGGAGCGTCTTGGCGGAAACTCGTCAATGCCAGTGCCTGTTACAGCCG
TACTGCTTGTCCACTAGCCTTAGCGTCCGTACTagcgtcgtcgtggtcgtcacTAGCTTCTAACTACTTGACGGTCGGCAAGTGGAGCATTTTGCCTTCT
CGCAAGCTGCAACGACTCATTTACACCGGAACAACGTCAATTCTCGCTAATTTAAAGGTTCCGCTGTCTCGTACATGCGATGGAACTGTTGTGACGAACT
CCAGCGCTGCTGATCCCGAGTCTTTATCGACTTCGCTTCGTCGTTTTATCCAATACGACGATATTCAAGTCGTTCAAGCTGCCGTCGACAGCTCAACCAG
TGCAACCAGCTCCGTCACGACCAAATTTGCTTGGACAATCTCCTACGGACATTGGGCTGGAACTTTGCCTACTTTTATACTTGCAGGCAGCAAGGAGTGG
ATACTCGTAGGTTATCCTACCATTGTAAACGCTGTCGTCACTCCAAACGACAGTATCCTAGAACTGGTTCCTCGCAGCTCAAGCACTACCAGTGCCACTA
CAACCCCCTAGTAACCAGAAACGTCAATGCAATGCAATGGTTTCATTCAATTTTAACACAAGGCAGTACCTTTGAAGCTGCCTAAACGGCGTTTTCCACC
TTGCTCAGACGCACAGCTTCTGCGAACTCTGCGATGGGGTTCACAGTCCACATGTTCGTCTCCTTTTCCTTCTTGCCATTTTCTTGCTGTTTCAGTGAAC
TCTCGTAAAACGCCAAGTGACCACCCGACTTGGTGGTGCACAGAATGACGTTCGGATTGGCTTCCACTTCCTTGTCCTTAGGTAACGCCGAGCTGATACT
GATCGGGTCGTCCTCAGCGTTGATGCAGAGCAACGGAACTCTCACAGCGCCCAGCTTTTTCACAGATCCAGCGTCGTTGTAGTAGTCGTCCACCGTGTCG
TAATGGAACACGTGCTTGGTAAGTGTGTCATCAAAATCTCGTACTGTTCGAGTGGCCTTAATAGCATCCAGATCCACTCCTGGGTAATTCTCAAACTGCT
GCGCGGCATTGCACTACCGTTAAACAATACACAAGCATTTTAGTTTAGTCATGTAAAAGGATAATAGCAGCCCCTATAGAACGAAAATTGCCTAGATAAA
CGCACCTTGTTGAAGAAAAGCTCGCGAAGGTTGTTGTTGAGTGCCTTGTCGTACGTCATGCGGTTGAACAAGGACCCTCCAAAGTTGGCCGAGCAAATGG
CCAAGTCGAACGGATTGCCAACCGAAATGGCTCCTGTCAAAGGTGTttgctctccatcttcgcCCAAATACTTGACAAGGACATTGGATCCCATCGAAAA
TCCCACACCGACAAAGGCTTCTTGGGTGAAATCGTACTTTTCACTCAATTGTTGCAATACGAAGCGTAGGTCTCCAGTGTACGCGCTGCAAAAGAGCTGT
GCAGTAGTCACTGGGGTATTCGCGCATCCTCGGGCGTTCAGCACCACACACTGCCAGCCCAGTTCCTGCAATTTGGCAATAGTACTGCGGATATAGTTCT
CCGGGCTCCCACCGGTGAGTCCAGGCAATAAAATCACTGTACGTCGCGTAGGTTCCACGTCCGCCAACCaggtcgtcgaagctgcggcgTTTGGGTCCTG
GTTGGGCACATTTTGGTCCTTCAACAGTGCCCAATCCAGAGAAACCACACCACCGTCCGGTAACTTCATTAATTGGCGCTTGTAATTGACTTTGGGCCCT
CGTTCATCGTAAGCGAATCGCACGGTCTGCAAATGTCCGTTAAACAGACGCCAAGGCGGGTAGTACTTGTTTTTTGCTGGGATTTGGAATAAAAAACAGT
TAGAGAAAATAAATAACAACAGTACAAACAAAAAAAGTGCTGCACGTACTGATGGTGGGGCAGTGTGAAAGCAGTTTCAGGTTGCTGTCAGTAGCGCAGT
ACACGAGTTTCGGCGTCTCAGCTGTGCGCATCAAGTGCCAG