Description :
From Genome Similarity Track
Location :
Scaffold_108:6332- 8302
Transcript NameFunction/comments
Physo_142073reverse transcriptase

Sequence
1970 bases(100 bases per row)
TGCGTAGACGAAGAAGGAGCGCTTTGAAGAGCAGAGCTGGGACTCGCTGAAGTCGAGTCCCTTCTACGAGATTCTACGGGAGCACGCGGACGTGCTTCCG
GAAGAGATCCCTGCGGAGCTTCCGCAGGACAAGGGCATCCAGCACGAGATTGATCTCGTGCCGGGGACGAAGTACTGTGTCACGCGGCAGTGGCCACTGC
CGCGAGAGCAGGTCAAGGCGATCGACGACTTCTTTGAGAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACAGTGCTCCGACGTTCTG
TGTCAAGAAGCCACAGGGCGGTTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGATACCGACGCAGACACCGATACCGCGAAAAGATATC
ATCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGCGCGATGGATTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACGGCAG
TGAGCACGCCGAGTGGCATGCTCTGGGAGTGGCTAGTGATGCCACAGGGTCTGAAGAACGTCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGCG
CTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTCCACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTGCATCTC
CGGAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGAAGTGCATCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTTG
GGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTGATCAATGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGC
CACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGGCTGCTGAGTGT
CAGCAGGCCTTCGATGCAGTCAAGCGGGGCTTGACTGAGGCGCCAATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGACGCATCCG
ACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCACGAGGGCCGTGATCGTGTCGTCTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAACTA
CCCGGTACATGACAAGGAACTCCTTGCCATGAAGTACGCACTCGCGAAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGACCAC
GCGTCGTTGCGGACGGCTGTGAAGTCGCCACACATCTCGCAACGGATGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAAC
CCGGAAGACTCAATGTGGTGGCCGACACGCTCTCGCGTCGACCTGACTACGCCACGACTGATGCCGACGTCAATGCCATTGACGCCATGCAATCGAGCAC
CCCGACGTCGTCACTGTTGGACGACGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCTTGCTGGCCTACGGCTCAGCGCCTTCTGACAAAGCT
CGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTACCGGGTGCTCGACGGGTTATTACTCTACAGTGCAGTCGACGACAACGCGGACCGCG
TTGTCGTGCCCAATGACCATGACCTGCGACTCAGGATCATGTACGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAGACATACCTTCT
TCTCACGCGAGACTTTTACTGGGCCCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTTCGCG
CAGGCTCCCTTGCAGTCACTACCAACTCCACGGGAGTGTTGGCAGTCCATGTCTTTGGACTTCGTGTTCG