Description :
From Genome Similarity Track
Location :
Scaffold_505:6331- 8093
Transcript NameFunction/comments
Phyag_g6241hypothetical protein

Sequence
1762 bases(100 bases per row)
CCGTGCACGCTGAGCTGGAGCAACCTCTCGTACACTGTTGAGACAAAGAAGACGATCAAGTGTTCGGATGGGAAGAAGACAATTCTAACCAGTGTCACTG
GACGATGCGCTCCAGGAGAGCTCACAGCCATTATGGGACCATCCGGATGCGGCAAGACTACACTACTTGACATTTTGGCAGACCGTATCTGCTCCGGCAC
TATCAAGGGTGACATTGCACTCAATGGCCAAAGGCGCAACGAGAATGAGTTCCGAGCAGTATCGAGCTACGTTGCACAGGAGGATTCACTATTAGGATCA
TTTACAGTGCAAGAGACTCTAGAGATGGCGGCAAGATTGACGATGCCCAATCGCACAGCCAATATCGCTATCGCTAAGCGAGTTCGGAGCGTCATTGACG
ACATGGGTCTGCGCGTCTGCGAGAACGCGATGGTTGGAGATATGTTCCACAAAGGGATTTCTGGAGGCCAAAAGCGTCGACTGAGTATCGCGATTGAAAT
GCTATCGGATCCACCGATCCTTCTCCTGGATGAACCAACATCAGGGCTCGACTCTGCTTCAACATACAACGTGGTGAAGCTCATTTCGCGCTTGAGCAAA
GAGGGTCGAACTATAGTGTGCACAATCCACCAGCCGTCATCTCTGGTCTACGAGCTATTCACAAACGTAGTCATCCTGTCAGCCGGTCGGACAGTTTACT
TCGGTCCTCGCACACGCATCCTCACCCATTTTTCATCTCTCGGTTACGACTGTCCACAATATCAAGACCCCATCGAGTACTTCATTGATCTCGCCAACAC
TGATTTCGAAGGCCATGGAGACATCGAACAGCTCGTCAACGGATATGCGAccagcgccgctgctgttcgcaTCGTCAGCGCCATTCGTACGGACGCCACG
GCCGATCTCGTGATGATGAGATCTACTGTTTTCTCTCGTCCGTCGCCGCTCCAACAATTCTCCGTGCTGTTACATCGAAACTTGCTGAACAATCTCCGCA
ACCCTGGAATTTACTGGGTCCGACTGGTAACTTACACTACATTGTCGTTCATGGTGGGCACTATGTATTTATCCACCAACCCAAAGATTATCGCCACCGA
CATcgtattgctgctggcgtaCGTCAACATCTACCTCGTCTTCTTATCTATCGCCGTATTGCCATTCTTCATCGAGCAACGTGCTATGTTCCTCCGCGAA
CGGACCAACAGCGGCTTGAACGTGTTCAGCTACGTGATCGCCAACTTCTTAGGCGCGTTGCCGGGTATCTTCCTCATTGCACTGAGTTCAACGCTGCTCG
TCGGGTGTTTGGCAGGGTTGAATTCCTACAGCGTGTTCCTGGTTGTGGTGTTCCTATCGCTCATCGTGGCCGAGAACCTCATGCACCTCATTTCAGCTGC
TGTGCCTCAATTTATTACCGGGATGGCGTTGGGTGCTGCGATCTTCGGGTGGTTTATCTTGGTCATGGGGCTATTCGTACCCGGCTCCGCCATGCCGAGC
TATTGGAGATGGGCGCATCACCTGGGCTTCCTCTCGTACAGCTTCGAGGCCCTATTATACAACCAGTTCAAAGATGATTCGTCACTGCAAGGCCAAGCAA
TTCTGGCCAAGTTCTCACTACAGGGCGTCCGCGTTGAACGAGACGTGGCCGTACTAGCGGCTAATGCAGTGGTGCTCGAGGTGGCGTTCGCTGCCATCCT
GTACAAATTCCACACTGGTCGACGGTAGCGAGCGAcagaagttgaagtttttcCACCGTTCA