Description :
From Genome Similarity Track
Location :
Scaffold_84:6330- 10578
Transcript NameFunction/comments
Phyin_T30-4PITG_19254Putative uncharacterized protein

Sequence
4248 bases(100 bases per row)
GATCTTGACGCAAGTTAAGATCCGCATGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTTTCTTCTAGATCCGGATCCGGATCCGCCTCTCTTCC
GTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACTTCCGACGACGCCTCTTCCCCTGGC
TCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGTTGTAGCGGGATCAGCAAA
ATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAGCGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCT
TGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTG
GAGCAGCAGTGGGAAATCTTCACTCTGCGTCCGTGGATGGTTCCGAATCCCAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGC
CGTAGGGTTGCCTTACGGGTGTGTTCCCTTGCCTTTGTAGCTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAAAGTTGAGAGCCTCTAG
GGTGTAACCGACCAAGTAGTAAATTCGGTTAGCCTGTCGGATTTGCACAAGTAAAGAAAAAGCTCACTAGGTTGTAGGATCTGGCCAATGTATTATCCAG
TTATCACTACCAACACTAGATTCGCATTTCCTAACTTCCTCCTAGCTCGTACGGTCAATGTAGTTGCGGTTCTTGAGGGCAGGAAGGCACTTGCGTGATA
CTGTGCAAATTGGGTTCTGTATTGATATTTAAGCCTATACCTGCCTGGATTTCTACCTTCTATGTCTTTCATCTGCTAAATTCCTTACCAGGCTCGGCTG
CATGTCCCTTCTTCCCTTGACCCATCATCCCAGCTGTGTTATCTTCAGATCCACCGGATCCATGACGTAATCATCATGGTCACCCTGTTATGGGTACACT
CATCCGGATCTAGGTCGCTTGGATCCACCTCGCTGTAATTGTACACTCGCCGTGGATCCGAGCTCTCCAATCATCCAACATCATCTTGCAACCGTCTGTG
ATCTCCTTGGTCCCACGAAAGTTCGAGATCCGCTGCATCCATCATCCCTATACCCTGGATCCAGGTCCCTCAAGGCGGGATCCTCCCTCCATGGATCCGA
ACTCGGAAGTATGGGATCCGGGGTACCTCGCGGTGGATCTTGACTCCTCGTTAGCCGTGGCTACTAGATCCACCTTCGGATGACACCTACCACCATTCCT
TCATAGGATCCACACTCGATCCACTGGTACCTAATGTATCCCATATCCACCTAAGTGAATCCAGGTAAGGGTGGATCCGAGATAAGTCTTGGTGGATCTT
GTCTTCTCGTACATCGCTCATACCAGATCCATCGTCATTCCATACGGGTGCCGCTCGTCATGGCTAATCCACNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGTAATAGTTAGCAAGGAGAAAAGCAAGCAGAATAAGCACCTTACTTACCGTGTTTGCAAATTTGGCTGA
CCCCACTTGTAGTAGCTGGGCTTGCAACTGAGCGATGAAACCGGTACTAATCCTGTCGTGCCCACCAATATCTGTAGTTAAAGTAAGTTTTGAATTCCTT
CTTCTGCTTAAGCTGTTTTGTTTTGATAGTTCATGTTGTGAATGTGGGCAGCTTGATCGACTGTATCAATCGCTAGAGCTTGTTGCTAATACTGAGAAAG
GGGCATATGTCTTCCACGAGGTCCCGTAGCCATGTTGATTTGGAAATGGTGTCGAATACTGAACTTATTGTGCTTTTTTGAAGGGTGACGACGGCGACAG
CTTCTACCTTGTCTACACCGGTCGAGGTAGGGGAAGGAGCGTCACACTAGAGATTCTCTCCTAAACGAATTTGATGTGCAGTGGAAGTGGTGAAGAAGGA
GGTTGGCAACCCAGCTCGCGTCAATGGAATCGTTCATTTAACATTCTTGGGGCCGGGAGATACCTTTGGAGAGAGGGCTTTACTTTCGAACACTGATGTA
CGCGCAGGTAAGCACTCGCCGTAAGCTGACTAAATGCGTGTATGGCTCTAAATCATTATTGGCTTAGCGTCTGTGATTATATCAACAACACCAACGGATC
TGGTTTTTATCAATCGCGTCGTGTTCAGCGAGCTACTCAAGGAATCACACGACTCTAGTAACACTAATACGCTCGAGATAACCAAACGGTTCCGCAGCAA
CAAAGACATCGTGCGCAATATTTTCATGAGAAGCTCTGCTCAGCGATCCGAGAAGGACCTGAAGTTTGCTGTCGAGTACTTAAAGAGTGTCAAATTCTTT
TCACGATTCTCTTTTGAAGTCCGAAAGCAGCTTTGTAAGGTGTTGCGCCTCATTAGTGCTGTCACAAACACAGTACTTTTCGCTGAAGGACAAGTGGGAC
GCCATTTCTACATCATTTTCTCAGGTTGTGTGGACGTATCGGTACGCACGAAGAATCGTTTCGATGAAACAAAAGAGAGTGTCGTCTCAAGGCTTGGTGA
AGGTGAATACTTTGGCGAGTTAGCGCTATCCCAGGTTGACGGTCTTCGTCGTGCCACTGTGGTTTGCACCGAATTCTGCGAACTGCTTATTCTAGGCCGT
GATGAGTACGAGCCGTTAATTAAGAAGTACCAAAACGAATATCACGCCCGGTACACCCAGATGCTGCGAAAGAATCCCTACTTCATTGGGCCCGAGTGGG
ATGACAATACCATTGAAGGCATGTGCTCCGTTATGACAGAAAAGTATATCCCGTTTCAAGGCGAAATCTGCAAGCAAGTAAGATTATTAGTTTGTAGGCT
TTATTCTTCACAATCTGACATTCATCGCTACAGGGATCACGAGCTAGCGAGCTCTTTATTGTAACGAGAGGCGAGTGTCAAATCATCCATGAAGGAAAAG
ACCCTATCACAAATGCGCGTCAAATGTACGAGCTGGGAAGATATGGAC