Description :
From Genome Similarity Track
Location :
scaffold_467:6330- 8007
Transcript NameFunction/comments
Pl_104618cryptochrome, putative

Sequence
1677 bases(100 bases per row)
CGGGAGGATGCAAGGCCGCAGCGACGAGCAATTGTCTGGTTCCGTCGCGACTTGAGGCTGCACGATAATTTGGCGCTGGATGCAGCAATCCAAGTGCAAC
AGGAGATGCAAAAGGCAGAGGAGGGAGACATGGCACTTCTGCCGATCTACATCCTGCACCGACCGAAGCACATGCAATGTGGAGCTGTGAGGTTTCAATT
CGTACTCGAGGCGATTGAGGACTTGGCGAAATCAATTGAAAACTTGCAGGGACGTCTTTTGGTGTTAAGAGGAGATGCTGAGGAGGTCTTGGCTGCTGTA
ATGGCTGCGTGGAAAGTCACGGATATCTTTTTCGAGGCTGGAGTCATGCCCTATTCAGTCGAGCGGGACGATCGCGTACGTGCTATTGCCAAAGATTTGG
ATATCAATGTGACGACGTGCCGCGGGGTCACGCTGTACGACCCGCATGAGATCATCCGATTAAATGGTGGACTGCCGCCTACGGACTATGAGGTGCTTCT
GGAGATCACTGCCAATATGACACAGCCAGCGCAGCCTCTGCCTGCACCAGTCAAGCTCGAGAATGCTGAAGTTTTCAGTACTAGTCAGTTGTACACATTG
CTGAAGGAGTTCTGTACAGATGCTTCAAACACTGCAAATGTGATGGCTGGAGTGGAGGATGATACAAAGAATACAGATGCAGATTTATTTGTGGTTCCTC
CTCTCACGGCGTTGGGATTGACCCCACCAGATACACACGCACCATTACTTGGAGGCGAAAGCGAAGCGTTGAAGAGGCTGGAAGAGTTTTGCAAGGATAA
CAAGCGTGTCGGACTCTTTGAGAAGCCAAAGACATCTCCTGTTGCAGTAAATGGTCCTTCCACCACGGCGATGAGTGCGTATCTCTCTTTTGGGTGTCTA
AGTGCACGCGAGTTTTATTATCGCATCATGTTCATCCAGCTCCAGTTCCCGCTTCGTCCTGGCCCCACACAGGTCACGCTTGAAGGTCAGCTCATGTGGC
GCGAGTTCTTCTACTGCTATGCATGCGGTACACCGAACTTCGACTCACAGGAACAGAATCCAGGCTGTAAGCAGATCGAGTGGCGGCTTCTTGACGAAGA
ACATGTACTCAAACCAGAGCATGACCTAAAAGAACAAACTAGCCTGACTGATGCAGACGAGAAACTCGCCATGCGCCAATTACAGTGCTGGAAGGACGGA
AAGACCGGCTTCCCATGGATCGACGCTGTCATGCGGCAGATTAACCAGGAAGGTTGGACGCACCATGCTGGGCGCCATGCAGTAGCTTGCTTTCTGACAC
GCGGAGTGCTCTACATCTCGTGGTTGCGAGGGGCTGCATACTTTCAAGAGAAGATGATCGATTTGGACTGGGCGATCAATGTTGGCAATTGGCTCTGGGT
GAGCGCGAGCTGCTTTTTCTCGAACTATCGTCGTGTGGCATCTCCATCCATGTTTCCACAGCGATGGGATCCACAAGGTCATTTCATCCGCAAGTACATT
CCGGCACTCAGTAAAATGCCTGACAGGTATGTACACGAGCCGTGGAAGGCGCCACTAAAAGTGCAGCGCGATGCCGGGTGCCTCATCGGCAAACACTATC
CTTTTCCCATCGTCGATAGCAAGCTGGCCATGTCGCGGTGTATAGCTGGTATGAGTCAAGCGTACTCCGACAGCGAA