Description :
From Genome Similarity Track
Location :
Scaffold_90:633- 2527
Sequence
1894 bases(100 bases per row)
CTGCACACTCCTGAAGAGACCTCTCCAGTGAAAATGATCGCGGATCCGCTGGTACGCCCGATCCCCTGGTGTCCACCTTCAAGAGTGGAGTGATAGTGAT
GCAACATAGCTTGATGCAGCGTCTCCGGTGCCACCAGTCTCATCAGTCCATCACGATCTGCCTCCGATCGTTTGGAGGGTGGGCAATAGAACAGCAGATT
ATCACCGTCGATCTCATAGTCCGATGCGATGTTGCCACAGGATCGAGCCTCCTCGTGTGCCAGATCAGCCACATCTCCCATCAGGTACTTCTTCATACCC
GCGATCCACGTCTCTTCATCCTGTGCTCGACAAATCCGATCGATCCGCAACTCTCGCACGAACTCCTCCTGCATGGCAGCCGGGTTCAGCCGTGATCTGG
CGCCCGATCGGGTGGTCATCGGCGATAGTCGGACGATCGACTCATCCGATCGAACGACCAGGATCTCATCAAGTCGGTTCAGTGTCACTAGATCCCCATG
ATCGGCATCATCCTCGACGACGACGCCCCCTTCACGTTGGAGTGCTGCACTGGCCAGGCTGTCCGCACTTCCGTTCCAGTCTCGTTTCACATGTAACAGC
TCGTGATCTGGCCAGTTCCGTAGTTGATCCAGCACCTTCTGCTTCAGCAATGTCAGCTTAGGTGCTTTGCAGTCGATCTCGCCCCGTACTTGTCGGATCA
CCAGGTTGGAATCACCGCAGACCACTAACCTGCCTCGATCTATGCCGTCAAGGAGGTCGAGACCCAACAACAGACCGTGATACTCCGCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCG