Description :
From Genome Similarity Track
Location :
Scaffold_121:63295- 64448
Transcript NameFunction/comments
Phyci_240958conserved hypothetical protein

Sequence
1153 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTATGAAGTGGG
AAAGGGGAACTCACTGCTTCTGGTGTGCTGTGAAGATTAAAATCCGCCAGCAAGAGTGCTCGGAGGCGCTGTACGAGACGCTCAAGGGCCGGTTGGCGCA
GGAGCTGCTGTGCCGCTGGTGGTACGCGATGGAGTGGCCGCCCGCAAAGAAATCAGCGCCGGTGGGTGGCGACAAATCACCTGCAGGTCTAGCGAGACGA
GGTCTCGTTGCTGATATGTTTGTCGTTGTGGTGGTGGTAGAAATTGCATGGAGTTCAGGAGCTCGACGGATTTCCTGGCGCCTTCATCCGCGTTAAGGTA
CTGCGTTTTGGCTGTTGCTATCAACTGCTTTGAGTGGGGATGGCGTTCATAGTGATTGATTTTTTTTATTCTTTTTCGTTGAATATCTAGGGTGATGACT
TAGGCTCGATCATAGACACTCGGTCATCCGTAGGCAAACCGTCGTTCCTGCACTTCTTCGCCATGCCCTCGGCGGATCTCCTCAAGTTGCTTCTTCAAGC
GTACGACAAGCAAATGGAGGTCTTGGTGGAGCACGAGGTTCGTGGAAAACGTTGTTTTTTTTGCGCTGAATACATGGTATCGACGCTGACGTTTGTTCTG
AACCGAACAGGGACCAGATACGTCGCTGTTGAAGGATCTGCAAAAGGAGCGCGCGTCGGCGTCCCGCATTGACCCGGATAAAGCCGACCGAAGCGTTCGG
AAGGTGCTGAAGGAATTCGCCGAGCTGGAGCGAGAGATCAAGGAGGTGCAGGCTCTCGCGCTCAAAGAGGAGGAAAacaacgatgaggacggcgacgaag
acgacgatgacgaggatgatgacgacgatgacgacTAGACAAGTGTGCCGCTG