Description :
From Genome Similarity Track
Location :
Scaffold_349:6328- 10970
Transcript NameFunction/comments
g10170.t1hypothetical protein

Sequence
4642 bases(100 bases per row)
GCCATGATGGTGGCATGGATGACATGATCTTTGAGTTCGACGATTCGCAGGCGTGTTCCGTTGCACAACCCCAGGTCGGGATTTAAGTTCCGCATCATGA
TGACCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTCAGGGAGTTGAGCACCTCCTGCTCGAATAAGTTCCCGTCCTCGTC
ATCCTCCACTGAGTCTGTGGACACATATTCTCGAGCTGGTCCAGTCATGCGATCCGCTACGGCTTCGTTGATACGATGGACTATCGCGTTCGTGGTGGTG
AGGATGGTGCGACTCGCAAAGTACTCGTCCGTTGCGACTTCCGAATTGTTGATGTCGGCGTACATCTCGTCGATCATGCGCCGCATACCTCGCGGAATAG
CTCCCGGTCGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGAGCATGTCACGTGGAATCTTAATGTAGTCATTTCCCAGATCGTTGTG
TACCTCGTGTCTCCCCTCTCCAACCTTCAGCAGGTACTCGGAAAACGCAGCCATTTCTGCAGCACTATCGGAGGTGGCAGCCGTGCGAACACGCATGTTC
TCTGTCAGACGCACCTTATGGAAAAGTGGCCACAGTTCGGATGACTTCAGGCATGCGTCGATTGTCTCTGTAGCCGAGCCGCCCTTCGCCACGGGGAGAA
TTTGCCTGAAATCTCCCGAAAGCACAACGACTTTCCCACCGAAAGGTTCTGCCTCGTTATCCAAAACATCACGAAGCGTTCTGTCCACTGCCTCAAACGC
GTGCCGATGCACCATGGGTGCCTCGTCCCAAACTATCAAACTTGCTTTCCTCATCAATTCAGTGACCTGGGATCGCTTGTTGATGTTGCAAGTAGATTCG
CCGTCTATCTTCAAGGGGATTTTGAAGGTAGAATGCGCTGTCCGACCTCCCATAAGCAGCAGAGAAGCAATCCAACTGGAAGCGACCGCGATTGCAATTT
TTCCGGATAGACGAACCTTGGCCAGTATGTTCCGAACCAGTGTCGACTTCCCGGTACCGCCTGGTCCATCAACGAAGAATAGCTTCCTGCCTTCCTGTGG
GTCCTCGACAGCTTGGGTGATCTGATCATAGGTCAAGCGCTGCTCCTCGTTTAGGTGGTCCTCCTCGCTCACAATTTGTTCAAGAACAGACGCGTCATAT
CCCGTTAGCTCTCGTCGGATGAGATTGTTTTGCAGAACAGACTCAAGCACCAGGCGAGGGAACTCGCTCAGCCGAGGGAGATCAAAGTCTTGAACGGAGT
ACCCACTGGCACTGAGCAAGTCTTGGATACTCTTCAGTGTGTCGAACGTCACAACAGACGTTTTAAAAGGGTCCAACATCTCTCGGTTCCTGTACGCATA
GTCAAGCGAAAGGTCTTTGAAGAATTGGTCCCAAAGACCCCGAACATCCGTAGGCGCCGAGTAGACCAAGATTGTTGCAAAGAGCTGGCGCAGCTGGTAC
GGCATCTGGAACTCGGCAGCCTCCGACAAACACAAAACCATTCGCTGTCGTTCTCCAGATAGCCGGCATGTTCAGCCGCGTCTCAATACGTGGGACACAG
CACACCATCAACTGTCCGCAGGTCTTCGAAAGACCTCAGTCCTCGGCGATGGCATAATAGCAGGCGTAAATAGAAGCGCTCCATATCACGCGGTGAAACA
TGCACCATCCGACCAATTGCAGCCTGGTACCTTTTACGTCGAACCCAGCACTTCGTGTTTCCCATCCAGCGGAATTCCTTGGGTATACCCTGGTACAGCA
TTGACTTCGCGATCTGGTTCTCGGGTTCGTCGCTCGCACACAATTCGAAGAAGCGGGTCAACATTGTGTGATTCCCACGACCAAGAACACGCTCCGGGTC
TTCCGTCGCTCTGAAGAACACGGTTTGGGCATCTTCAACGTGAACGGTAAGCTGAGTGACTGCGTGTGTCTTTCCTTGGATCAAGAAGTCGAGTAAACGG
ATACAGGCTTCAACTGGAGATATGTACCTGGCCGTGAGGAAGCGCAGAATCTCGTTTGGCTCTTGCCGAGGGAGCTCTCCACCCGCGCGAACTGCCTCGA
CAGTTAGCACAGCTTTATCGGACCCTTTGTAGACGTACTTGTATAGATATTTCACAGCTGAAATATCCGTGCACACCTCGACGTTGATGTGGCAATTGTA
CTTTTGGGATAAGTACGGGTTGTACGGAACAACCCACTGGTTAATAGTGGCGCTGTCGTACTCCCTGCCCTTCCATACCAGGACGCCTTCAGCTCGTCGA
CGCCGTCTGTAGACCGGATAGCCGTTCCCATTGGTCCTTGTCGCCTCTGCAAAAGGTTTCGGATATCCTTTCGTACACTTCCCGTCCTTCATGCAAGCGC
ATGACGGGTTTGCCGCTCCACAGGGTCCATGCAGCATGCATGTCATGATTGTCTCGAATAGTTGCGGGAACTTTTCTCTGTCAGGAAGCTCTGCAGACAC
CATACGATCTACGATTTGGCGAGTACGTGGCTTGTCCTCTTCAGCCAAAATGATCAAGATGTGCGCGTGAGGGAGCCCTCTCTTTTGAAACTCGACCACG
TAAATCCGCGCTTCCATACGGCCCAGCACTCCTTCGCTCAGGTCTTTAAGCTGAGCTTGCAGCTTTTGCTGCCAGACACGGGCTACAATATCGGGGCGGT
CCTGAGCGTTTTGTTGATCGGACCCAAGGGCCTCGACTATCTCTTCCCATGTAGGGCTGCAGGTCGTTGTCATGAACACATCAGGCTTGCCGAATTCTTT
AACAATGGCCATTGAGTCTTGGTAGGACTGGTACATTGCGCGAGGACTGCCCATATGAGATGAGGGCAGAATAACGCGGCGTCCCACTTGGTTGAGAAAA
TGGGTATCACCACCACGGCCTCGATCAGAGTGGACCAACGTACCATCGCCTCTGTCAAACTCGGAGAGTAGCCCTTCGCCTGCTTCCAGCTGAATTGTAC
CTTCGTTAAGCAGTGCGTCCTGAAGCCCTCTGTACTGATCGGCGCGAATTTGCTTCTGATGTGAGGCCACCCAGCGAAGTTGCTCCTGCTCGCATTTAGC
GCGTTGGTCGACACACCACTGCTGAAAGAGACGGCCGCCTTGATGAAGAGCAGACTGATCTCCCACTTTTTGGTGCAACCGGAAGGCGACATGTTCGCGA
AGGGACATCTGGTTCTTGTTGCGACGTCTGACTCCGTTCGCGTATGTGTCCATGTAGGTCCAACCCAGCTCCCCATATGGAAGCAGAAGAGGGTACTGAA
GCGGATCATACTCCGGGCGCGTCTCGAACAGTCGCAGAAGCCTGTGATCCCGAGTATACAGTAGTAGATCGCGAGGCCTATCCAGGTTGCCGTCCTCGAT
GAGCGTCGCGCCTACCTCAGAAACGGTTGGCAAATTGTATGTCCGAGGATGCGCTATATTTTCGTGGAGGCGGAACACCATATCCACGACGGCGCTCGTG
TCTCACGAGCGCACTTGCTCTCCGAAACTCAGGAACTGTTGAGCAAATGGGTTGTGCTGCTCCATCATTTGGTCAATGTCCATCAACGCCACAGGATCCA
AGTCAGCAAAAATTCCTCTGCGGCGTTGGGCGCGCTGCTGCATGTCCGGGTCCACAATATAGATCTGCGCGAACTTAGGGTCCGTGCGCTCTCCGGTGGC
GGGATCAATATAGGGGAGTAGAAATCCCAAGTAGTGACCCATTGCACCCTGGATGCGGTACGTGTACACGCCCCTCTGTCCCGCTACGCTTGCATCCTGG
TTGACGTCCTGGAAGGATCGGTTGGAGCACGAAGCGCCAATGGACGTGAACGCAAAAGCTTGGTTATACGCTCGTATGTGTTGTCGAAACGCTGGATCCC
GGTACAGTTGCAACAATCTTGGACGTGCAGGCCGTAAAGGGGGAAGACGAACCTTGTCTTCCAGACAACAGCTCATTTTGGATTCGCCAGGCCACTTCCA
AGCGCCACAATGTTCACAAACAGTGGTGGGAGGAAGCCGATGGCGCCCATTCACAACGTCTGGACCCTGGACGTAGGCCACGTCAAAATCGTCGTGGTTT
GCCAACGCCTCTCCACGTCGAGCCGATCTACGCCGAAATCGCTCTCTCTCGCGTTGCTCAAGTGCTTCTTCCTCGGTCTGTTCTCTGCGGCGTTCCGCAT
GTTGTTCTTGGTTTACCATGCGTTCTTCGGCGCGTTCCTCCTGGGTAAGCTGTGATCTGCGCTCCGCGTGTTGCTCTTGGTTTACCCTTCGCGCTTCAGC
ACGCTCCTCCTGCGTGAGCTGAGACCGGCGCTCCGCGTGTTGCTCACGATCTGTTCTGCGCTCTTCAGTGCGATCCTGTACACTCCTGTGAAGCGCGCGA
GAAGCACTGTTGCGTTCACGCTCCTCGGCGTGGACCTCTTCGTTCAGATTATGCCGACGTTCCTGCTGTGCGAACCGGTTTCGCTCTCGTACGTCCTAAA
GCTGCTCGGCACGGAGCTGGGCTCGCCGGGCTAACTTTCGCTCCGCGTCACGCCGCCGCGCACTCTCCCGCTGAGAGTCGGTCATGTTACTTCTTCTGGA
ACGCGCTCGCTGCGCCTCCCTCATCCGACGTGGATTTACTTG