Description :
From Genome Similarity Track
Location :
Scaffold_177:6327- 8661
Transcript NameFunction/comments
Hyaar_Emoy2811940N(4)(BetaNacetylglucosaminyl)Lasparaginase putative

Sequence
2334 bases(100 bases per row)
TCTTCTGATTGCGATGTAGCCTATTCAACCTCATAAGTAAATTAGCATTATAGGTGAAAATTTGTGATAAGATAACTAATTGCGACCGCGTAGTAAGTGT
AATTCACACACGCACCAATTTCTGCACGTGAGTAGCTAAAAGTGTCGAAGGTCGAACAGAGGGCTAACAAACGAACATAGGGCTAACAAGCAAATGATCG
ACACTTAGAGCGTGTTTATAAAGGTAACTGAAACGTTTGTTGAACTTCTCATTGAACCTCTGATCGAACCTTTTGATTGAACCTTTAGTTGAGTCAAAGT
ACCTCCCCTAGGTACTTTGAAATTTCAACTAATAGTTGAGCGATAAAGTGGTCTCGCTACTTAAAGGGTGCTTGATCAGTTCCAATATAGAACCTCTGTT
TTCTGGACCTATGCTCATGTCAGCGAGCTCCATAAGGTTTATTGTTGTGTCATCCCGGCTGTAGTGCTGAAAAGACCCAACAACAAATGCCCGTTTCTAA
CAATTAAAATCTGTATGTCGTGATCGTAGAAGGAGACGTTATAGGTGGCTGCTGACGGTGATCTTTGGTCGATTCATTGATTTTAGAGCTGTATTAATCA
GCACAACATTCCAGATGCACCAACGCCTTTGCGCGTTCGGCGTGCATGCTTCAATTCGGTTAAAAGATTTTACGATCGTATTAACTTATAACAACGATAA
CATTGATCAAAGTGACTGAAGATTAATGCAAAAATAGACTGTTGATAGCTATATAATAGCTCATGTCTGTCACTGCTTTCTTTATGTAGTCTATTATGGC
GTATTGTCGTATGGTTCTGTCACAATCATGGACATGCTGCAGCTTCTATTGCTGTTGGGATTTGGGTAGTAATACATGAACTAAGTAAGAGCTCTTGTTT
GCCTACAAGCCTGCTGCGTCCACTTGACATAATATATATATTTGACACAAAAAGAGCATGTTGCAGCCTGACTTATCCTTTGACAGGCATTGTTCGCTTT
TTGCTTGAAGCATATCAATGTTTCGCTGTGTGTGCACATGGAGATCCAATTGCACCTCATTTGTAGGCTTAGTAAACATCTAACACTCGAACTTGAGAAA
CACAAACGGCAAGACGTACTATGTTATGCTGATTAAGCCATATTACAGTACAGCTGCCCAAGACCACCTTGATACCATGATCGACATCCATAAGTCACAC
ACACTGCAAGTGCTGCCGCGAAGAACGCCAAACCCAAATTCCCAGGCTCGGTGAGAAAAAAGATCTGATGGCGGCGTCTCTGACAGCGAGCCCGAACAAA
AGTGGTGGTGGTGACCGCCATTTTCCTGAGCTGGATTTTTGGTGGTAGTTTAGGGGTGGAAAGTAGGATCGCCAAAACGAAATGGAGGTTAAATGTGTAA
TTAATATTTTTTTAGAAGTGTTTTATAAACAGCACCGGTAGTTGAACCCCTAGTTGAACCTCTCGTTGAAACAGTAATTCAAGCAGTAGTTGAAATGCCG
CTCAATTACCTTTGTAGACGCGCTCTTAGAGGCAGCGAAAATCTCGCACCTGCTGCAAACGGCAGATGTGAAGTTCTTTTTCATCCAAAGTACTTAATAT
AGTGAATAAGTAAGAATTTATTGTCGCCTTTATCCCTTGGTAGCAGAAGAAGCTCCTGTGATTCAATCTCTCTTTATGATGAACCCATTATATTTTGTCG
GCGTTCTCGAGCAGGATTATTCCCGTCTCTCTTTTCTCAACGTCCGCCTTTCTAAAACATCAACAACATTAACCAGTAGCTTAAACACCACAATCTGTAA
TCACTCTCACATATCCGACACAGTAGCCGCCGACCACTTGGAATGTTACGTGTGTAACGGGGTGCCTCCGTTACATGATAATTTACTTAAGGTAAATATC
AAGCACGAATATTGCGTGAGGACAAACACAATATTCTCACAATATTATCCTAATAGATAATATTGCCCCGCAGATGTAACACACTGTTCATTGGTTGATA
TCAGGATATCAACCAATAAAGTCTAGCCACGACAGAAGCACGCAACGAGTGGCGCACAGATAGTTATAATACATGTTTGTATTTAGACATAGTTTAATGA
AGTCAAATAGGGATTTATTACAAGGATTACTATACTATATACAGTTGTACTTTTTACCTTTACTGAGTACTCTTACTCCGTATTCTTTTTTCTTTGCATG
TACGTGTACGTGAGGTAGTCGGAAGCACACATCCTTGCACTGTCAGCAGTGCAAGGTTTATTCAGTTACTTGAATAAGGTGTGCCCCGTTACAACGTGAA
TACACAGAACTAAATTCAGTTCCTTGGACTGAAA