Description :
From Genome Similarity Track
Location :
Scaffold_662:6327- 8258
Transcript NameFunction/comments
Phymu_g11422hypothetical protein PHYSODRAFT_469730

Sequence
1931 bases(100 bases per row)
CTTGAACATCAGGATCATGCCGCATCGATCATCTGGACGTAGCAGTGGCGAgtgctccagttcctcagCCTTTCGACACTCCACTCTCGGTTTCGACGGC
CTCAGCTGAGCTGAGATTGAGACCCACGAGACGATGTTGTCGTCCGAGTTGGGAGGTTTAgcgagcaccagcagcactccGACCTCCTTGAAGACGGACT
ACGCTATCCTGGAGAGCAACACACCAGTGGAGTGCACGCAGATCCACTACGAACAAGAAAAGAAGCGGCAGCGTAAATGCTCTGGAGCTCTACCAACGCC
CAAGATTCAGGGACGAGTGACCCGATCGCCACGGCCACGGACCAGCTCAATTGTTGCGATGTTAGGGGGATCTGGAGCCAACAAGCGGACGCTGGGCAAC
TCCGGACTCTCGAACTCCCGCGTTAACGGCTTaagcagcagccactcgAGCTTCTTACCGAGCAACTCGGTTCTTACCATGAGTTTCCACCCTTCTATGA
CGAACATCTCGCGACCAAGTCGGAAGATGAATATGAGCGAACTGCACGAGTTCAAAGACCAGCTCTGGAAAGGGTCCATGTCAGCAGTCAGTACGGAAGA
CTGCGCGAACCCGAAAGCCCCAGGCCAattggccttcttcgcccAAGCGTTCAACACGTCGCGTGTTACCGTCAAACACAAGGAACCGGCCGATGACGCG
ACGGTTTTCATCCCTTTGCCTCGAGAATCCGTCGCGATGATGGTCGACGCCGTTCGAgtgtcggcgctggaagACAATGAGAAGTGCAGGTTCCTCTTCG
AGATGTTTGACGTCGACCACCGAGGAGTGTTGTCAAAAGAAGGGGTCAGAGCGTTCATCGAGGCCACCTTCGCTGCCAATGGCGTCCAGTTTCTCGGTGA
ATTAGACTACGACGGAGTGGTGGATAAAGTCTTCGATCGCTGTCGTCAACACGACAAAATGACTTACAGCGAGTTCTGCAGTGTATTCGGAGAGATCGTG
GCCGAAGTTGACGACGAAAAGAGCAAGGAGGCCCTCGGGAGGTTAAGTTTCATTCTGGAAGCTCAACAACTCAAGGAAAATGTCCACAATAATGAAAACG
GAGGTCAATGGTACCGCTTCCGGAAGTTCTGTCGAAAGTACAAGCCCGAGATCTTCTGGCTCACGCTCTACTTCCTGCTCATGgtcggcgtcttcatcgc
caaagCCTCGCGCTTCCCGTTCGACCCTGCCGTCGGCAACTGTCCTCGAATCGCCAAGGGATTCGCCGAGATCTGCCTCGTCAACACcatgttcgtgctg
ctgcccaTGTGTCGGAACTTCGTCACTGGCCTTCGGACGTTGCCTGTGGTGGTCAATTACCTGCCCATCGACCACCACATCGAGTTCCACAAGATCTGCG
GCATCGTGATGTTGGTCGCTTCTGTGGGCCACACTGCAGCGTGGTTGGCCATCGTCATCTACGTCCGCACTGTCCCGCTCTCGGTCTGGGAAGCCTCTCG
CTATCACCATCTCTCCTTTGTACGGGACGAGAACTTACTGCTGTTTGCGCTACGAGTTCCGATCTGGACGGGAGTGGCGATGCTTCTGTGTGCGGCCATC
GCAGCTCCGTTGTGTCTGGAGAAGGTCCGACGGGGGAAGTTCAACTTGTTCTTCATCACGCACATGCTGTTCATCCCGTTCGTCGTCTTGATGGCGTTCC
ACGGCTTCGCTCGGTGGGTGGCCGCTCCACAGGCGCAGTACTGGATTTTGCCTCCAGTCGTGATCTTTATGATTGAAAAGCGCTACCGGATGACGCAAAT
GTTCGGCGGACAAACCAAAATTATCCACGTTCAGCATTCCAAGGAATCGGTGGCGATTTTCATGAAGAAACCCAAGGGATTCAGCAAGAGACAACGGTTT
CTCCCTGGgatgtacgtgtacgtgaacgTTC