Description :
From Genome Similarity Track
Location :
Scaffold_2:632681- 633953
Sequence
1272 bases(100 bases per row)
aatcaggttgacgcgataacgcgtcgcccactacgttgagtcttacgggtttgttctccacccggaagttgtactccgcgaagaatgacaaccatctctc
catacgttgcgagatgtgcggcgatttaatcgccgtgcgcagtgatgcgtggtcggtgtagaccaccaatggtctactaagtaaatacgctcggaacttt
gcgagtgcatacttcatggcaaggagctccttgtcatgtacagggtagttgcgctcagctggcttcagctgacgcgactgatagtagaccgcacgatcac
gcccctcgtgatcgtgttgcatcaatgcacatccgatcgcgaaatcggatgcataacgcactacgtggaatgggcgatcttggtcggcaacggccaagat
cggagcctccgtcaagccctgcttgactgcatcgaacgccccctggcattcggtcgtccaattccactcagcttcctttttaagaagctggcgaatcttg
accgcgtagttatccacgtacttgcacaagtacgtggcaagcccaaggaactgcctcagttccttcactttggatggcgtgggccattcattgatcactc
tgaccttctctggatcaaggcgcacgccgtctttccccacgagacaccccagcacgggtatctcgttcgccccgaagatacacttcttcaggttcgcata
aagcttatgcttcctcataagctctagcagcttccggagatgcaccttgtgcatctcaatgtccaccttcccgttcacagcccggctgtggacgaacacg
tcgtcgaagtagctcggtgcgaagtcgcgcaccgagcgcaatagatatgtcacacatatattgaacgtcgcaggggcattcttaagtccctgtggaatga
cgagccactcccacagcatacctctgggagtgcttaccgctgtgagagggatgtccctctcacgcatgaggatttgatagaacccatcacgcagatctag
agcactgaagacagtgctcaagcccatcgaatcgatgatcacatcttttcgcggtatcggcgtctgcgccggtatcgtcgcatcgttcaacttgttgtac
gcatgaacgatgcgccagccgccctgtgccttcttgacacagaacgtcggggcactttgcggggacttcgattcccgcacttgacctgcaagacgacgac
tctcgaagaagtcgtcgatcgcttgaacttgttcacgcggcagtggccactgccgtgtaaagcaatccttcg